URBAN SOLID WASTE PROCESSING METHOD (MSW)

专利摘要:
municipal solid waste (msw) processing method, and biodegradable component slurry unsorted msw processing methods are provided using microbial fermentation with lactic acid bacteria alone or in combination with added cellulase enzyme activity. biogenic components of msw are sufficiently hydrolyzed so that a biodegradable slurry can be easily separated from non-degradable components. the recovered biodegradable slurry provides a fast and improved biomethane substrate.
公开号:BR112015030765B1
申请号:R112015030765-5
申请日:2013-12-18
公开日:2021-08-03
发明作者:Georg Ørnskov Rønsch；Jacob Wagner Jensen；Sebastian Buch Antonsen
申请人:Renescience A/S；
IPC主号:

专利说明:

FIELD OF THE INVENTION
[001] The invention relates, in general, to solid waste processing methods and, in particular, to methods that rely on microbial fermentation.
[002] Municipal solid waste (MSW), particularly including household household waste, waste from restaurants and food processing facilities and waste from office buildings comprises a very large component of organic material that can be further processed into energy, fuels and other useful products. Currently, only a small fraction of available MSW is recycled, with the vast majority being dumped in landfills.
[003] Considerable interest has emerged in the development of effective and ecological methods for processing solid waste, to maximize the recovery of its inherent energy potential and also the recovery of recyclable materials. A significant challenge in “waste to energy” processing has been the heterogeneous nature of MSW. Solid waste typically comprises a considerable component of degradable organic material mixed with plastics, glass, metals and other non-degradable materials. Unseparated waste can be directly used for incineration, as is widely practiced in countries such as Denmark and Sweden, which rely on district heating systems. (Strehlik 2009). However, incineration methods are associated with negative environmental consequences and do not achieve effective recycling of raw materials. Clean and effective use of the MSW degradable component combined with recycling typically requires some method of separation to separate degradable from non-degradable material.
[004] The degradable component of MSW can be used in “waste to energy” processing with the use of both thermochemical and biological methods. MSW can be subjected to pyrolysis and other modes of thermochemical gasification. Organic waste thermally decomposed at extremely high temperatures produces volatile components such as tar and methane as well as a solid waste or “coke” that can be burned with less toxic consequences than those associated with direct incineration. Alternatively, organic waste can be thermally converted to "syngas" comprising carbon monoxide, carbon dioxide and hydrogen which can be further converted to synthetic fuels. See, for example, Malkow 2004 for review.
[005] Biological methods for converting degradable components of MSW include fermentation to produce useful end products such as ethanol. See, for example, documents no. WO2009/150455; WO2009/095693; WO2007/036795; Ballesteros et al. 2010; Li et al 2007.
[006] Alternatively, biological conversion can be achieved by anaerobic digestion to produce biomethane or “biogas”. See, for example, Hartmann and Ahring 2006 for review. The pre-separated organic component of MSW can be converted to biomethane directly, see eg document no. US2004/0191755 or after a comparatively simple “pulping” process involving milling in the presence of added water, see eg , document no. US2008/0020456.
[007] However, the pre-separation of MSW to obtain the organic component is typically costly, ineffective or impractical. Source separation requires large infrastructure and operating expenses as well as the active participation and support of the community from which the waste is collected – an activity that has proved difficult to achieve in modern urban societies. Mechanical separation is typically capital intensive and additionally associated with a large loss of organic material, on the order of at least 30% and often much greater. See, for example, Connsonni 2005.
[008] Some of these problems with separation systems have been successfully avoided through the use of liquefaction of degradable organic components in the unseparated waste. Liquefied organic material can be readily separated from non-degradable materials. Once liquefied into a pumpable slurry, the organic component can readily be used in thermochemical or biological conversion processes. Liquefaction of degradable components has been widely reported using high pressure and high temperature “autoclave” processes, see eg documents in US2013/0029394; US2012/006089; US20110008865; WO2009/150455; WO2009/108761; WO2008/081028; US2005/0166812; US2004/0041301; US 5427650; US 5190226.
[009] A radically different approach to the liquefaction of degradable organic components is that this can be achieved using the biological process, specifically through enzymatic hydrolysis, see Jensen et al. 2010; Jensen et al. 2011; Tonini and Astrup 2012; WO2007/036795; WO2010/032557.
[010] Enzymatic hydrolysis offers unique advantages over “autoclave” methods for the liquefaction of degradable organic components. With the use of enzymatic liquefaction, MSW processing can be conducted in a continuous manner, using relatively inexpensive equipment and unpressurized reactions performed at comparatively low temperatures. In contrast, “autoclave” processes must be conducted in batch mode and generally involve much higher capital costs.
[011] A perceived need for “sterilization” in order to reduce possible health risks posed by pathogenic microorganisms generated in MSW was a predominant theme in support of the predominance of “autoclave” liquefaction methods. See, for example, documents no. WO2009/150455; WO2000/072987; Li et al. 2012; Ballesteros et al. 2010; Li et al. 2007. Similarly, it was previously believed that enzymatic liquefaction required thermal pretreatment at a comparatively high temperature of at least 90 to 95 °C. This high temperature was considered essential, in part to effect a “sterilization” of unsorted MSW and also so that the degradable organic components could be softened and the paper products “pulped”. See Jensen et al. 2010; Jensen et al. 2011; Tonini and Astrup 2012.
[012] It has been revealed that safe enzymatic liquefaction of unseparated MSW using isolated cellulase preparations can be achieved without high temperature pretreatment. In fact, contrary to expectations, high temperature pretreatment is not only unnecessary, it can be actively harmful as it kills environmental microorganisms that are growing in the waste. Promoting microbial fermentation concurrently with cellulase hydrolysis under thermophilic conditions typically between 45 and 55 °C improves “biodegradable capture” either with the use of “environmental” microorganisms or with the use of selectively “inoculated” organisms. That is, the concomitant thermophilic microbial fermentation reliably increases the organic yield of “biodegradable slurry” that is recovered. Under these conditions, the pathogenic microorganisms typically found in MSW do not develop. See, for example, Hartmann and Ahring 2006; Deportes et al. 1998; Carrington et al. 1998; Bendixen et al. 1994; Kubler et al. 1994; Six and De Baerre et al. 1992. Under these conditions, typical MSW-generated pathogens are easily overcome by abundant lactic acid bacteria and other safe organisms.
[013] In addition to improving "biodegradable capture" from enzymatic hydrolysis using isolated cellulase preparations, concomitant microbial fermentation using any combination of lactic acid bacteria or microorganisms that produce acetate, ethanol, formate, butyrate, lactate, pentanoate or hexanoate “preconditions” the biodegradable slurry to make it more effective as a substrate for biomethane production. Microbial fermentation produces biodegradable slurry having a generally increased percentage of dissolved solids compared to suspended solids, relative to biodegradable slurry produced by enzymatic liquefaction using cellulase preparations alone. Higher-chain polysaccharides are generally more completely degraded due to microbial “preconditioning”. Microbial fermentation and concomitant enzymatic hydrolysis degrade biopolymers to readily usable substrates and, in addition, achieve metabolic conversion of primary substrates to short-chain carboxylic acids and/or ethanol. The resulting biodegradable which comprises a high percentage of microbial metabolites provides a biomethane substrate that effectively avoids the rate limiting “hydrolysis” step, see eg Delgenes et al. 2000; Angelidaki et al. 2006; Cysneiros et al. 2011, and which offers additional advantages for methane production, particularly with the use of very fast “fixed filter” anaerobic digestion systems.
[014] Surprisingly, sufficient liquefaction of degradable non-separated MSW components prior to separation of non-degradable material can be achieved within a relatively short processing time, typically 36 hours or less, by microbial fermentation alone, without any need for preparations of isolated cellulase. An improved "fast" biomethane substrate comprising a high degree of dissolved solids and bacterial metabolites can be achieved, even when the initial separation of non-degradable material is achieved by microbial fermentation alone, by the simple feature of continued fermentation of the biodegradable slurry recovered after the initial separation of non-degradable solids. REVIEW OF THE FIGURES
[015] Figure 1. Schematic illustration of main aspects of the demonstration plant.
[016] Figure 2: Sum of concentration of lactate, acetate and ethanol in the biogenic slurry obtained with and without supplemental cellulase activity provided by isolated enzyme preparations.
[017] Figure 3. Biodegradable capture in kg of TS/kg of waste (A). In biogenic slurry after 3 mm sieves. (B) Total catch including material retained by sieves.
[018] Figure 4. Degradation of cellulosic substrates and model MSW by microbial inoculum and CTEC3.
[019] Figure 5. Comparative degradation of cellulosic fraction of model MSW by microbial inoculum and CTEC3.
[020] Figure 6. Conversion of dry matter in enzymatic hydrolysis concomitant with CTEC3 and microbial fermentation.
[021] Figure 7. Bacterial metabolites recovered in supernatant after enzymatic hydrolysis concomitant with CTEC3 and microbial fermentation.
[022] Figure 8. Graphical presentation of the REnescience test reactor.
[023] Figure 9. Capture of biodegradable in biogenic slurry during different time periods expressed as kg VS per kg of processed MSW.
[024] Figure 10. Bacterial metabolites in biogenic slurry and aerobic bacterial counts at different points in time.
[025] Figure 11. Distribution of bacterial species identified in the biogenic slurry of example 7.
[026] Figure 12. Distribution of the 13 predominant bacteria in the biogenic slurry of example 9.
[027] Figure 13. Up and down ramp of biomethane production using biogenic slurry from example 9.
[028] Figure 14. Up-slope and down-slope characterization of biomethane production of the “high lactate” bioliquid from example 6.
[029] Figure 15. Up-slope and down-slope characterization of biomethane production of the “low lactate” bioliquid from example 6.
[030] Figure 16. Upward ramp characterization of biomethane production from hydrolyzed wheat straw bioliquid.
[031] DETAILED DESCRIPTION OF ACHIEVEMENTS
[032] In some embodiments, the invention provides a method of processing MSW comprising the steps of - providing an unsorted stream of MSW to a microbial fermentation reactor in which the MSW is fermented with agitation at a non-aqueous content between 10 and 50% by weight and at a temperature between 35 and 75 degrees for a period between 1 and 72 hours under conditions sufficient to maintain a concentration of live lactic acid bacteria of at least 1.0 x 1010 CFU/L, and - removal from a fermented raw MSW stream from the reactor and subjecting the reactor to a separation step whereby non-degradable solids are removed to provide a slurry of biodegradable components.
[033] Naturally occurring strains of Lactic Acid Bacteria (LAB) present in the residue have been previously presented to provide effective conversion, to lactate, of model kitchen waste comprising fruits, vegetables, grains, meat, fish and the like. See Sakai et al. 2000; Sakai et al. 2004; Akao et al. 2007a; Akao et al. 2007b. No particular inoculation procedure was needed to produce an effective lactate fermentation of the residues - they were simply ground in an equal volume of water, then heated to temperatures between 37 and 55 °C. A community of naturally occurring strains typically emerged, with one or other species clearly emerging as dominant. See Sakai et al. 2004. However, in order to facilitate large-scale processing, it is advantageous to keep fermentation times as short as possible during the initial step before removing non-degradable solids. Some degradation by microbially derived enzyme activity must generally be achieved prior to the separation of non-degradable solids. Ideally, the biodegradable component of MSW is liquefied prior to separation, meaning that sufficient degradation has occurred so that the slurry of dissolved and undissolved solids is pumpable.
[034] When lactic acid fermentations are conducted using substrates that include a large percentage of cellulosic and lignocellulosic materials, isolated cellulase enzyme preparations have typically been used to promote cellulase hydrolysis concurrently with fermentation using lactic acid bacteria. See, for example, Abe and Takagi 1990; Parajo et al. 1997; Chen and Lee 1997; Schmidt and Padukone 1997. In addition, many LAB species, including almost all Lactobaccillus species tested, and many Pediococcus species were shown to exhibit extracellular cellulase activity. See, for example, Yang et al. 2001; Matthews et al. 2004; Matthews et al. 2006; Gao et al. 2008. Thus, it is possible to practice methods of the invention using a microbial fermentation comprising primarily or even singly LAB and independently achieve effective levels of cellulase activity.
[035] Any suitable solid residue can be used to practice methods of the invention. As will be understood by a person skilled in the art, the term “urban solid waste” (MSW) refers to fractions of waste that are typically available in a city, but which do not need to come from any municipality per se. MSW can be any combination of cellulosic, plant, animal, metal or glass waste, including but not limited to any one or more of the following: Garbage collected in normal urban collection systems, optionally processed in some sorting device, fragmentation or central pulping, such as Dewaster® or reCulture®; solid waste separated from homes, including organic fractions and paper-rich fractions; waste fractions derived from industry, such as restaurant industry, food processing industry, general industry; waste fractions from the paper industry; waste fractions from recycling facilities; fractions of waste from the food or food industry; fraction of waste from the medical industry; residue fractions derived from agriculture or from sectors related to farming; fractions of processing residues from products rich in sugar or starch; agricultural products contaminated or otherwise spoiled, such as unexploitable grains, potatoes and sugar beets for food or food purposes; gardening debris.
[036] MSW is, by nature, typically heterogeneous. Statistical data regarding the composition of waste materials are not widely known. that provide a firm basis for comparisons across countries. Standards and operating procedures for correct sampling and characterization remain non-standard. In contrast, only a few standardized sampling methods have been reported. See, for example, Riber et al., 2007. At least in the case of household waste, the composition varies seasonally and geographically. See, for example, Dahlen et al., 2007; Hansen et al., 2007b; Muhle et al., 2010; Riber et al., 2009. Geographical variation in household waste composition has been reported, even at short distances of 200 - 300 km between municipalities. See Hansen et al., 2007b. As a general rule, the dry weight of modern Western European urban waste typically comprises the order of 25% by weight of “vegetable and food waste”. In China, by contrast, the relative proportions of “food waste” are typically increased by a factor of at least two relative to Western European MSW. See, for example, Zhang et al. 2010.
[037] In some embodiments, MSW is processed as "non-separated" waste. The term "non-separated" as used herein refers to a process in which MSW is not substantially fractionated into separate fractions such that the biogenic material is not substantially separated from plastic and/or other non-biogenic material. As used herein, the term “biogenic” refers to materials that are biodegradable and comprise materials derived from living organisms. Residues may be “unspeared” as used in this document despite removal of some large objects or metal objects and despite some separation of plastic and/or other non-biogenic material. The terms "non-separated waste" (or "non-separated MSW"), as used herein, refer to waste comprising a mixture of biogenic and non-biogenic material in which 15% by weight or more of the dry weight is non-material. biogenic.
[038] Typically, unseparated MSW comprises biogenic waste, including food and kitchen waste, materials containing paper and/or cardboard, food waste and the like; recyclable materials including glass, bottles, cans, metals and certain plastics; other combustible materials, which, although practically non-recyclable per se, can provide heat value in the form of waste-derived fuels; as well as inert materials including ceramics, stones and various forms of debris.
[039] In some embodiments, MSW can be processed as "separated" waste. The term "separated" as used herein refers to a process in which MSW is substantially fractionated into separate fractions such that biogenic material is substantially separated from plastic and/or other non-biogenic material. The term “separated waste” (or “separated MSW”), as used herein, refers to waste in which less than 15% by weight of the dry weight is non-biogenic material.
[040] In some embodiments, MSW can be source-separated organic waste comprising predominantly fruit, vegetable and/or animal waste. A variety of different sorting systems can be applied to unsorted MSW in some embodiments, including source sorting, where households dispose of different waste materials separately. Source separation systems are currently available in some municipalities in Austria, Germany, Luxembourg, Sweden, Belgium, Netherlands, Spain and Denmark. Alternatively, individual separation systems can be used. Mechanical separation and classification means can include any methods known in the art, including, but not limited to, systems described in documents US2012/0305688; WO2004/101183; WO2004/101098; WO2001/052993; WO2000/0024531; WO1997/020643; WO1995/0003139; CA2563845; US5465847. In some embodiments, waste even if it is slightly separated, still produces a fraction of waste that is “non-separated” as used herein. In some embodiments, unsorted MSW is used, where greater than 15% by weight of the dry weight is non-biogenic material, or greater than 18%, or greater than 20%, or greater than 21%, or greater than 22%, or more than 23%, or more than 24%, or more than 25%.
[041] In practicing the methods of the invention, the water content of the MSW is adjusted so that the MSW comprises a non-aqueous content between 10 and 50% by weight, or in some embodiments, between 12 and 40%, or between 13 and 35%, or between 14 and 30%, or between 15 and 25%. In some embodiments, the water content is considered to be "adjusted" as used herein, wherein the MSW comprises the appropriate non-aqueous content, with or without water being added directly. MSW typically comprises considerable water content. All other solids comprising MSW are termed "non-aqueous content" as used herein. The level of water content used in practicing the methods of the invention relates to several interrelated variables. The methods of the invention typically produce a biogenic slurry. As will be readily understood, slurry is biogenic in that it predominantly comprises biogenic material, but may also include non-biogenic contaminants. A slurry is "liquid" as used herein in that it is pumpable despite the substantial undissolved solids content.
[042] As will be readily understood by one skilled in the art, the ability to transform solid components into a liquid slurry is increased with increased water content. Effective pulping of paper and cardboard, which comprises a substantial fraction of MSW, in some countries is typically improved when the water content is increased. The water content provides a medium in which the microbial preparation can propagate and which dissolves metabolites. Also, as is well known in the art, enzymatic activities may show decreased activity when hydrolysis is conducted under conditions with low water content. For example, cellulases typically show decreased activity in hydrolysis mixtures that have a non-aqueous content greater than about 10% by weight. In the case of cellulases, which degrade paper and cardboard, an effectively linear inverse relationship has been reported between substrate concentration and substrate output per gram of enzymatic reaction. See Kristensen et al. 2009.
[043] In some embodiments, some water content must normally be added to the waste in order to achieve a suitable non-aqueous content. For example, consider an unsorted Danish household waste fraction. Table 1, which describes the characteristic composition of unsorted MSW, reported by Riber et al. (2009), “Chemical composition of material fractions in Danish household residue”, Residue Management 29:1251. Riber et al. characterized the component fractions of household waste obtained from 2220 Danish households in a single day in 2001. It will be readily understood by a person skilled in the art that this reported composition is simply a representative example, useful in explaining the methods of the invention. In the example shown in Table 1, without any added water content, the biogenic biodegradable fraction comprising vegetable, paper and animal waste would be expected to have approximately 47% non-aqueous content on average. [(% absolute non-aqueous)/(% in net weight)=(7.15 + 18.76 + 4.23)/(31.08 + 23.18 + 9.88) = 47% non-aqueous content] . The addition of a volume of water corresponding to an equivalent weight of the waste fraction being processed would reduce the non-aqueous content of the waste itself to 29.1% (58.2%/2) while reducing the non-aqueous content of the degradable component to about 23.5% (47%/2). The addition of a volume of water corresponding to two weight equivalents of the waste fraction being processed would reduce the non-aqueous content of the waste itself to 19.4% (58.2%/3, while reducing the non-aqueous content of the component degradable to about 15.7% (47%/3) TABLE 1 SUMMARY MASS DISTRIBUTION OF DENMARK WASTE FRACTIONS 2001 (a) Pure fraction (b) Sum of: newspaper, magazines, advertisements, books, paper office and clean/dirty, paper and cardboard boxes, cardboard, box with plastic, box with Al plate, dirty cardboard and kitchen fabrics. (c) Sum of: Soft plastic, plastic bottles, other hard plastic and non-plastic recyclable. (d) Sum of: earth, stones, etc., ash, ceramic, cat litter and other non-combustibles. (e) Sum of: Al containers, al plate, metal-like sheet, metal containers and other metals (f) Sum of: Clear, green, brown and other glass (g) Sum of: The remaining 13 material fractions.
Vegetable waste (a) 31.08 7.15 Paper waste (b) 23.18 18.76 Animal waste (a) 9.88 4.23 Plastic waste (c) 9.17 8.43

[044] A person skilled in the art will readily be able to determine an adequate amount of water content, if any, to add to the waste in the water content adjustment. Typically, as a practical matter, despite some variability in the composition of MSW being processed, it is convenient to add a relatively constant mass ratio of water (which includes aqueous solution), in some embodiments, between 0.8 and 1.8 kg of water per kg of MSW, or between 0.5 and 2.5 kg of water per kg of MSW, or between 1.0 and 3.0 kg of water per kg of MSW. As a result, the actual non-aqueous content of MSW during processing can vary within the proper range.
[045] A variety of different microbial fermentation reactors can be used. In some embodiments, a reactor similar to that described in document WO2011/032557 can be used, including a chamber that rotates on a substantially horizontal geometric axis, equipped with accessories on its inner surface that form a spiral arrangement, which moves the MSW continuously from the input to output end. Depending on the degree to which the reactor is filled, and depending on the size of the reactor, the average “residence time” of the MSW inside the reactor can be controlled. The reactor can be equipped with heating elements so that a suitable temperature can be maintained. While continuously introducing MSW into the reactor and continuously partially removing the degraded MSW from the reactor, a certain average residence time is obtained. In other embodiments, large vessels, possibly consisting of concrete or other simple building materials, can be used which are equipped with means for agitation, such as a horizontally mounted shaft having vanes which lift and mix the input MSW. The reactor can be equipped with means for passive aeration, whereby exposure to air is provided and agitation facilitates exposure to air. Alternatively, the reactor can be configured to effectively maintain anaerobic conditions by limiting exposure to air.
[046] Agitation can be achieved by a variety of different means. Agitation is advantageous as it promotes not only microbial fermentation per se, but also hydrolysis catalyzed by enzymes secreted by or otherwise provided by living microorganisms. In fact, in this context, microbial fermentation is effectively hydrolysis and fermentation. In some embodiments, agitation is provided by a type of free-fall mixture, such as a rotating vessel or a horizontally mounted shaft providing lifting and mixing of MSW into the microbial fermentation medium. In other embodiments, agitation can be provided by simpler means such as drills.
[047] A variety of different media can be used to achieve and maintain a lactic acid bacteria concentration of at least 1.0 x 1010 CFU (colony forming unit)/L during the fermentation cycle. As used herein, the concentration of lactic acid bacteria is maintained at a concentration during the fermentation step, prior to the separation of non-degradable solids, as the concentration of live bacteria cells in the fermentation is, on average, of at least 1.0 x 1010 CFU/L per fermentation cycle. An average of at least 1.0 x 1010 CFU/L during fermentation is typically demonstrated by a series of measurements on samples taken before or after or during fermentation. The measurement of UFC/L is determined by a measurement expressed as UFC per g of total solids present in a representative sample of the mixture and then expressed as a measurement per L by a measurement of total solids content of percentage by weight of the mixture. . The percentage of total solids of a representative 5 ml sample is determined by drying at room temperature to provide a basis for calculations. CFU is determined using quantitative PCR (qPCR). 5 ml aliquots of sampled material suspended in 50% by weight glycerol are suspended in 5 ml of sterile filtered H2O. An aliquot is filtered through a filter and DNA is extracted from the filtered cell mass. The number of 16S rRNA gene copy numbers in the extracted DNA are quantified by qPCR analysis with universal 16S rRNA gene primers. Bacterial cell number is calculated based on this data, assuming an average of 3.0 gene copy numbers of 16s rRNA per living cell and expressed in terms of the total solids content of the analyzed sample. Archaeal counts are not included in the UFC/L count. The percentage of measured live cell counts that correspond to lactic acid bacteria is determined based on an estimate provided by 16S rDNA analysis, as is well known in the art. A liquid fermentation mix sample is frozen in 20% by weight glycerol and stored at -20°C for the purpose of performing 16S rDNA analysis to identify microorganisms. This analysis is well known in the art and is widely used for identification and phylogenetic analysis of prokaryotes based on the 16S component of the small ribosomal subunit. The analysis comprises genomic DNA extraction, amplification library preparation using the universal primer primer pair spanning hypervariable regions V1 to V3 27F: AGAGTTTGATCCTGGCTCAG / 534R: ATTACCGCGGCTGCTGG; 507 bp in length), PCR tagging with GS FLX adapters, and sequencing to get 104,000-160,000 reads per sample tested. The resulting sequences can be queried in a BlastN against the Ribosomal Database Project's rDNA database (Cole et al., 2009). The database contains good quality sequences at least 12.00bp in length and a taxonomic association of NCBI. The current release (RDP Release 10, Updated September 19, 2012) contains 9,162 bacteria and 375 archaeal sequences. BLAST results can be filtered to remove short and poor quality matches (sequence identity > 90%, alignment coverage > 90%). The numerical percentage of bacteria detected by this analysis that are lactic acid bacteria, including, but not limited to, Lactobacillus species, is then applied to the tial measured UFC/L as a fractional measure of LAB UFC/L. For example, when 2.0 x 1012 UFC/L of total live bacteria counts are determined in representative samples of a fermentation mix, and when analysis of 16s RNA from representative samples of the fermentation mix indicates that 50% of micro- organism detected is Lactobacillus species, the lactic acid bacteria concentration is established at the time of measurement to be at least 1.0 x 1012 CFU/L.
[048] It is generally quite simple to achieve lactic acid bacteria concentrations of at least 1.0 x 1010 CFU/L. Whether the aeration conditions are aerobic or anaerobic, LAB will generally comprise a larger proportion of the medical population that develops when MSW is simply incubated at temperatures between 37 and 50 °C. See, for example, Akao et al. 2007a; Akao et al. 2007b; Sakai et al. 2000; Sakai et al. 2004. Likewise, microbial fermentation conditions can be aerobic or anaerobic. Counts of live LAB bacteria in the order of 1.0 x 1010 CFU/L can be routinely obtained within about 12 hours in domestic model residue lactic acid fermentation, with no added enzyme activity. See Sakai et al. 2000 and Sakai et al. 2004. Lactic acid bacteria generation folding times identified in the examples presented subsequently are reported to be in the order of 4 to 5 hours. See Liong and Shaw 2005.
[049] In some embodiments, the incoming MSW stream is simply inoculated with an inoculum of naturally occurring microorganisms in the waste and optionally "raised" into local waste or local waste components as a food source under fermentation conditions of temperature within the range 37 to 55 °C, or 40 to 55 °C, or 45 to 50 °C, and at a pH within the range 4.2 and 6.0.
[050] Because LAB generates acidic metabolites, its continued growth typically involves a requirement for pH adjustment to maintain proper growth conditions. Typically, LAB prefers pH conditions within the range of 4.2 to 6.0. In some embodiments, pH adjustment during microbial fermentation can be provided by microbial means, for example, by including in the microbial fermentation mixture yeast or bacteria or other microorganisms that convert acidic products into a non-acidic one, such as the methods described by Nakaski et al. 1996 and Nakasaki et al. 2013.
[051] Generally, it is advantageous to achieve biological separation in the shortest practicable time, ie to maintain the duration of microbial fermentation before the separation of non-degradable solids as quickly as practicable. This can be achieved with particular speed by providing an initial inoculation of the incoming unsorted MSW stream. In some embodiments, the inoculum may simply be recirculated process water, which may advantageously be heated to temperatures between 37 and 55 °C. In some embodiments, the inoculum itself transmits live LAB concentrations of at least 1.0 x 1010 CFU/L to the incoming MSW stream. In some embodiments, refrigeration-dried cells can be directly added as an inoculum. In some embodiments, biodegradable MSW components of a particular location can be used as a substrate, in which a lactic acid bacterial inoculum is generated in the fermenter and introduced into the incoming unsorted MSW stream. In some embodiments, the incoming MSW stream can be subjected to heat sterilization so that a specific strain of lactic acid bacteria can be inoculated that has specialized advantageous properties.
[052] In some embodiments, the concentration of live LAB is maintained at levels of at least 1.0 x 1010 CFU/L or at least 2.0 x 1010 CFU/L or at least 3.0 x 1010 CFU/ L in the microbial fermentation reactor during continuous operation, with an incoming MSW stream being introduced continuously and a fermented MSW stream being continuously removed before separating non-degradable solids, for a period of at least 20 hours, or at least 50 hours, or at least 70 hours. In some embodiments, microbial fermentation can be conducted concurrently with enzymatic hydrolysis using isolated enzyme preparations. In these realizations, live LAB levels during microbial fermentation prior to separation of non-degradable solids can be much lower, on the order of 5.0 x 107 CFU/L, or between 5.0 c 107 CFU/L and 1.0 x 1010 UFC/L.
[053] In some embodiments, microbially derived cellulase activity of at least 30 FPU/L is provided by the microbial pool providing microbial fermentation. As used herein, the term microbially derived cellulase activity refers to an activity that is not directly provided by an isolated enzyme preparation that has been added to a fermentation mixture, but rather to an activity provided by living organisms. In some cases, living organisms can provide cellulase activity by secreting bulky cellulite enzymes. In other cases, living organisms can provide cellulase activity in comparably local contact with cellulosic substrates. Microbially derived cellulase activity is determined as follows: A sample containing live microbes is incubated with the addition of a clean, pure cellulose substrate, either tissue paper or filter paper, for a period of 24 hours under conditions of temperature, pH and aeration for which activity measurement is desired. Solid mass transferred from cellulosic substrate added to liquid phase, corrected for "base" transfer from solid mass to liquid phase by the microbe-containing sample itself, and corrected for solid mass "base" transfer from cellulosic substrate added to phase liquid by water alone, under the reaction conditions tested, provides a measure of microbially derived cellulase activity. This measure is then compared to activity under equivalent conditions by an isolated cellulase enzyme preparation having known cellulase activity in Filter Paper Units (FPU), as determined by the method of Ghose, T.K. (1987), Measurement of cellulase activities. Pure & Appl. Chem., 59(2): p. 257-268. The [(percentage transfer of sample-base and water-base solid mass from cellulosic substrate to the liquid phase reached by the microbe-containing sample) divided by (percentage transfer of water-base solid mass from cellulosic substrate to liquid phase achieved by the isolated enzyme preparation)] times the known FPU activity of the isolated enzyme preparation provides a measure of microbially derived cellulase activity. This activity measurement is then divided by the reaction volume at which the measurement is taken to provide a measurement expressed as FPU/L. It will be readily understood by one of ordinary skill in the art that the microbe-containing sample may have been diluted prior to measurement, and that a final estimate of FPU/L at the sample source may involve a correction for dilution. In cases where some component of FPU activity provided by an isolated enzyme preparation is combined with microbially-derived cellulase activity, the microbially-derived cellulase activity measured is simply corrected by a linear subtraction of the activity provided by isolated enzymes in isolation from the microbial context . An example calculation is given as follows: A 20 ml microbial inoculum sample is incubated for 24 hours in the presence of 1 g of added cellulosic substrate. After correction for the release of base solids by the inoculum sample itself, a liquid total of 12% cellulosic mass is observed to transfer from the cellulosic substrate to the liquid phase. A 20 ml buffer sample to which 1 g of added cellulosic substrate is added and an isolated cellulase preparation previously measured to have known FPU activity in an amount corresponding to 5.7 FPU/g of cellulose is incubated for 24 hours under equivalent conditions. A net total of 62% cellulosic mass is observed to transfer from the cellulosic substrate to the liquid phase. A 20 ml sample of water to which 1 g of added cellulosic substrate is added is incubated for 24 hours under equivalent conditions. A net total of 3% cellulosic mass is observed to transfer from the cellulosic substrate to the liquid phase. Some small amount of isolated enzyme preparation having known FPU activity is added to the fermenter from which the microbial inoculum has been removed in an amount which, expressed in terms of the total volume of fermenter content, can be expressed as 8 FPU/L . The microbially-derived cellulase activity measured is given by: [(12% corrected autobase transfer - 3% water base transfer)/(62% transfer - 3% water transfer)] * (5 ,7 FPU/0.020 L) = 43.5 microbial initial FPU/L - 8 FPU/L of isolated enzyme contribution = 35.47 FPU/L of microbially derived cellulase activity.
[054] In some embodiments, microbially derived cellulase activity can be provided by specialized cellulase secretion organisms, which has been included in an inoculum applied to the incoming MSW stream. In some embodiments, microbially derived cellulase activity can reach levels of at least 50 FPU/L or at least 75 FPU/L or at least 100 FPU/L or at least 300 FPU/L or at least 500 FPU/L or at least 700 FPU/L, or at least 1000 FPU/L. In some embodiments, it may be advantageous to add isolated enzyme preparations to the microbial fermentation mixture, including amylase preparations or other enzyme preparations.
[055] The duration of microbial fermentation before separation of non-degradable solids is determined by the average residence time within the microbial fermentation reactor. In some embodiments, average residence time of MSW flux in microbial fermentation before separating degradable materials is 18 hours or less, or 24 hours or less, or 36 hours or less, or between 36 hours and 48 hours, or between 48 hours and 60 hours, or between 60 hours and 72 hours, or 72 hours or less. In some embodiments, the invention provides a biodegradable slurry obtained by the MSW processing method.
[056] A fermented MSW stream is removed from the microbial fermentation reactor, typically on a continuous basis. That is, a stream of unsorted MSW is continuously introduced into the reactor and a stream of partially hydrolyzed, fermented MSW is continuously removed from the reactor. In some achievements; however, MSW flow can be introduced in a pulsatile fashion, with an injection of MSW, followed by a pause, followed by a subsequent injection of MSW. Similarly, in some embodiments, the flow of partially hydrolyzed, fermented MSW can be pulsatilely removed from the reactor, with an ejection of MSW, followed by a pause, followed by a subsequent ejection of MSW, and so on.
[057] After removal from the microbial fermentation reactor, the fermented, partially hydrolyzed MSW is subjected to a separation step, whereby the non-degradable solids are removed to provide a slurry of biodegradable components. This separation step, and subsequent processing, can be achieved in a variety of different ways.
[058] In some embodiments, the separation step is achieved in two steps. First, a ballistic separator removes two streams of non-degradable materials, producing a "two-dimensional" (2D) fraction comprising plastic bags and another generally shapeless material, a "three-dimensional" (3D) fraction comprising bottles and containers having a defined shape, and a volume of a biogenic liquid slurry of biodegradable components. In a second step, the 2D fraction is further subjected to pressing with a helical press or similar device to further increase the production of the biogenic slurry.
[059] In some embodiments, the 2D fraction is further subjected to washing in order to recover more of the biodegradable material. The wash water obtained in this step can then be kept at the fermentation temperature and used to moisten and also inoculate the non-separated incoming MSW.
[060] In some embodiments, the processing scheme described in Figure 1 can be used. Figure 1 presents a schematic illustration of key aspects of the REnescience Version 1 demonstration plant. Unseparated MSW undergoes a biological separation process that produces four products - a biogenic slurry suitable for biomethane production or other inert processes (glass and sand) for recycling, and both a “two-dimensional” (2D) and a “three-dimensional” (3D) fraction of inorganic materials suitable for RDF production, as well as for recycling metals, plastics and wood. MSW from urban areas is collected as is in plastic bags. The MSW is transported to the REnescience Waste Refinery, where it is stored in a silo until processing. Depending on the character of the MSW, a separation step can be installed in front of the REnescience system to extract oversized particles (above 500 mm). An unseparated MSW stream is heated and its non-aqueous content adjusted by the addition of heated aqueous solution. In some embodiments, cellulase activity provided by the isolated enzyme preparations can be added to facilitate rapid degradation of the biodegradable component of MSW. In some embodiments, isolated enzyme preparations are added to heated MSW at a suitable non-aqueous content. In some embodiments, no isolated enzyme preparations are added and microbial hydrolysis and fermentation are provided to maintain lactic acid bacteria during the fermentation cycle at live bacterial cell levels of at least 1.0 x 1010 CFU/L. MSW, with or without added enzymes, can be incubated in a microbial fermentation reactor similar to that described in WO2011/032557. While continuously introducing MSW into the reactor and continuously partially removing degraded MSW from the reactor, a certain average residence time is obtained. Partially degraded MSW removed from the reactor can then be subjected to two distinct separation steps. First, a ballistic separator, commonly used in separation, can be used, for example, having sieves between 20-50 mm to produce a biogenic slurry flow, as well as a 3D non-degradable fraction and a 2D non-degradable fraction.
[061] In some embodiments, as shown in Figure 1, the non-degradable 2D fraction can be further subjected to dehumidification using a helical press, with the recovery of additional biogenic slurry which is, in turn, mixed with the slurry obtained from ballistic separator step.
[062] In some embodiments, as shown in Figure 1, the biogenic slurry obtained can be subjected to additional "fine" separation using a series of vibrating sieves, for example, a 6-10 mm coarse sieve, for example, 8 mm, followed by one or more finer 2-6 mm sieves, eg 3 mm. These coarser sieves typically separate mostly non-degradable contaminants. Finer sieves, for example 3mm sieves, typically separate larger fibers which comprise a considerable amount of biodegradable material. After passing through the finest sieves, in some embodiments, the biogenic slurry obtained, which is typically pumpable (ie, liquid) can be stored in a large tank.
[063] In some embodiments, biodegradable materials retained by one or more sieve systems can be reintroduced into the stored biogenic slurry and subjected to post-fermentation, in order to achieve more complete degradation of the material, at a temperature between 35 and 75 degrees per a period between 1 and 72 hours.
[064] In some embodiments, as shown in Figure 1, the dehumidified solid undegradable 2D fraction may be subjected to a counter-current washing mechanism both to clean the 2D fraction and also to recover additional biodegradable material that otherwise way, it would be lost. For example, water flows, in some embodiments, may be as shown in Figure 1. Fresh water may be applied to wash non-degradable 3D material recovered from the ballistic separator in a simple drum. This wash water can then be used as "clean" water which is fed into the second of two identical wash units, in order to provide backwash, - the new "clean" water meets the "cleaner" waste , while consecutively dirtiest water is applied to the “dirtiest” incoming garbage. In some embodiments, the washing mechanism works as follows: the 2D soiled fraction enters a drum in the first washing unit, where the residue is mixed with the counter-current washing water and mechanically mixed. Additionally, the dirty wash water can be subjected to sieve filtration having sieves of 0.04 to 0.08 mm, to remove fibers, which typically comprise mainly biodegradable material. Sand and heavy material can also be removed by sedimentation and a helical conductor at the bottom of each washing unit. The fraction removed is typically mostly sand/glass/hard plastic/and other inorganics. After the first wash, the residue can be moved by twist drill or other means into a second wash unit, which can be identical to the first. The wash water of the first wash unit, in these embodiments, typically has between 1 - 4% by weight of TS (total solids), while the wash water of the second wash unit typically has 0.5 -3.0% in Weight.
[065] Wash waters, comprising some biodegradable material recovered from the MSW, as well as associated microorganisms, in some embodiments, can be stored in a "buffer" tank. The aqueous solution from this “buffer” tank can then be used to adjust the non-aqueous content of the incoming MSW. In some embodiments, the “buffer” tank solution can be heated by applying steam, then mixing the heated solution with the input MSW so as to simultaneously heat to a suitable temperature and also adjust the non-aqueous content. In some embodiments, the "buffer" tank solution is heated alone in the buffer tank to a temperature within the range of 35 to 55 °C. The mere heating action of the buffer tank that stores wash water is sufficient to induce fermentation and promote bacterial growth, enriching the solution's ability to serve as an “inoculum” to the incoming MSW to facilitate microbial fermentation. In some embodiments, the heated "buffer" tank that stores wash water can then be stirred, pH adjusted, and "fed" with biodegradable material retained by one or more sieve systems or by the biogenic slurry obtained or both, in order to further promote bacterial fermentation and in order to further improve the “potency” of the solution as an inoculum for the incoming MSW.
[066] The separation of non-degradable solids and the scheme to promote microbial fermentation can be achieved by a variety of means. In some embodiments, the incoming MSW stream can be fed to the microbial fermentation reactor, then, after a period of microbial fermentation, directly subjected to pressing with a helical press, with biogenic slurry separation, followed by the addition of fresh water , followed by a second screw press treatment, producing a dilute biogenic slurry recovered from the second screw press treatment that can be used to adjust the non-aqueous content and provide inoculation of the incoming MSW stream. Or, in some embodiments, a similar scheme is applied directly and some or all of the biogenic slurry is used to adjust the non-aqueous content of the incoming MSW stream.
[067] In some embodiments, the incoming MSW stream can be fed into the microbial fermentation reactor, then, after a period of microbial fermentation, subjected to a separation step such as ballistic separator or drum separator or vibrating sieve, with some recovery of the biogenic slurry, followed by pressing with a helical press to recover the additional biogenic slurry, some of this slurry can be used directly to adjust the non-aqueous content of the incoming MSW stream.
[068] In some embodiments, microbial fermentation is carried out concurrently with enzymatic hydrolysis. Enzymatic hydrolysis can be achieved using a variety of different means. In some embodiments, enzymatic hydrolysis can be achieved using isolated enzyme preparations. As used herein, the term "isolated enzyme preparation" refers to a preparation comprising enzyme activities that have been extracted, secreted or otherwise obtained from a biological source and optionally purified partially or extensively.
[069] A variety of different enzymatic activities can be used to advantage to practice the methods of the invention. Considering, for example, the composition of MSW shown in Table 1, it will be readily apparent that, at least in Denmark, paper-containing waste comprises the largest single component, by dry weight, of the biogenic material. Likewise, as will be readily apparent to a person skilled in the art, for typical household waste, cellulose degradation activity will be particularly advantageous. In paper-containing waste, cellulose was previously processed and separated from its natural occurrence as a component of lignocellulosic biomass, mixed with lignin and hemicellulose. Likewise, paper-containing waste can be advantageously degraded using a comparatively "simple" cellulase preparation.
[070] "Cellulase activity" refers to the enzymatic hydrolysis of 1,4-B-D-glycosides in cellulose. In isolated cellulase enzyme preparations obtained from bacterial, fungal, or other sources, cellulase activity typically comprises a mixture of different enzyme activities, including endoglucanases and exoglucanases (also called cellobiohydrolases), which catalyze endo and exo respectively. -hydrolysis of 11,4-BD-glycosidic bonds, with B-glucosidases, which hydrolyze the oligosaccharide products of exoglucanase hydrolysis to monosaccharides. Complete hydrolysis of insoluble cellulose typically requires a synergistic action between different activities.
[071] As a matter of practice, it may be advantageous in some embodiments to simply use a commercially available isolated cellulase preparation optimized for the conversion of lignocellulosic biomass, as they are readily available at a comparatively low cost. Such preparations are certainly suitable for practicing the methods of the invention. The term “optimized for the conversion of lignocellulosic biomass” refers to a product development process in which enzyme mixtures have been selected and modified for the specific purpose of improving hydrolysis yields and/or reducing enzyme consumption in the hydrolysis of pretreated lignocellulosic biomass into fermentable sugars.
[072] However, commercial cellulase blends optimized for hydrolysis of lignocellulosic biomass typically contain high levels of additional and specialized enzyme activities. For example, we determined the enzyme activities present in commercially available cellulase preparations optimized for the conversion of lignocellulosic biomass and supplied from NOVOZYMES ™ under the trade names CELLIC CTEC2 ™ and CELLIC CTEC3™ as well as similar preparations supplied from GENENCOR ™ under the trade name ACCELLERASE 1500 ™ and revealed that each of these preparations contained endoxylanase activity above 200 U/g, xylosidase activity at levels above 85 U/g, BL-arabinofuranosidase activity at levels above 9 U/g, activity of amyloglucosidase at levels above 15 U/g and α-amylase activity at levels above 2 U/g.
[073] The simplest isolated cellulase preparations can also be used effectively to practice the methods of the invention. Suitable cellulase preparations can be obtained by methods well known in the art from a variety of microorganisms, including aerobic and anaerobic bacteria, white rot fungi, soft rot fungi and anaerobic fungi. As described in reference 13, R. Singhania et al., “Advancement comparative sand profiles in the production technologies using solid-state sand submerged fermentation for microbial cellulases,” Enzyme sand Microbial Technology (2010) 46:541 to 549, which is by medium herein expressly incorporated by reference in its entirety, cellulase producing organisms typically produce a mixture of different enzymes in appropriate proportions so as to be suitable for the hydrolysis of lignocellulosic substrates. Preferred sources of cellulase preparations useful for converting lignocellulosic biomass include fungi such as Trichoderma, Penicillium, Fusarium, Humicola, Aspergillus and Phanerochaete species.
[074] In addition to cellulase activity, some additional enzyme activities that may prove advantageous in practicing the methods of the invention include enzymes that act on food residues, such as proteases, glucoamylases, endoamylases, proteases, pectin esterases, pectin lyases and lipases and enzymes that act on garden waste, such as xylanases and xylosidases. In some embodiments, it may be advantageous to include other enzyme activities such as laminarases, keratinases or laccases.
[075] In some embodiments, a selected microorganism that exhibits extracellular cellulase activity can be directly inoculated in carrying out concomitant enzymatic hydrolysis and microbial fermentation, including, but not limited to, any one or more of the following thermophilic and cellulytic organisms can be inoculated alone or in combination with other Paenibacillus barcinonensis organisms, see Asha et al 2012, Clostridium thermocellum, see Blume et al 2013 and Lv and Yu 2013, selected species of Streptomyces, Microbispora and Paenibacillus, see Eida et al 2012, Clostridium straminisolvens, see Kato et al 2004, Firmicutes species, Actinobacteria, Proteobacteria and Bacteroidetes, see Maki et al 2012, Clostridium clariflavum, see Sasaki et al 2012, new species of Clostridiales phylogenously and physiologically related to Clostridium thermocellum and Clostridium straminisolvens, see Shiratori et al 2006, Clostridium clariflavou m sp. Nov. and Clostridium Caenicola, see Shiratori et al 2009, Geobacillus Thermoleovorans, see Tai et al 2004, Clostridium stercorarium, see Zverlov et al 2010 or any one or more of the thermophilic fungi Sporotrichum thermophile, Scytalidium thermophillum, Clostridium straminisolvens, and Thermonospora al curvata, et al. . 2008 for review. In some embodiments, organisms exhibiting other extracellular enzymatic activities can be inoculated to contribute to concomitant enzymatic hydrolysis and microbial fermentation, eg proteolytic and keratinolytic fungi, see Kowalska et al. 2010 or lactic acid bacteria that exhibit extracellular lipase activity, see Meyers et al. 1996.
[076] Enzymatic hydrolysis can be conducted by methods well known in the art, with the use of one or more isolated enzyme preparations that comprise any one or more of a variety of enzyme preparations including any of those mentioned above or, alternatively, inoculating the process MSW with one or more selected organisms that may affect the desired enzymatic hydrolysis. In some embodiments, enzymatic hydrolysis can be conducted using an effective amount of one or more isolated enzyme preparations that comprise cellulase, B-glucosidase, amylase and xylanase activities. An amount is an "effective amount" in which, collectively, the enzyme preparation used achieves solubilization of at least 40% of the dry weight of the degradable biogenic material present in the MSW within a hydrolysis reaction time of 18 hours under the conditions used. In some embodiments, one or more isolated enzyme preparations are used in which, collectively, the relative proportions of the various enzyme activities are as follows: A mixture of enzyme activities is used such that 1 FPU of cellulase activity is associated with at least 31 CMC U of endoglucanase activity and such that 1 FPU of cellulase activity is associated with at least 7 pNPG U of beta glucosidase activity. It will be readily understood by one of skill in the art that CMC U refers to carboxymethylcellulose units. An activity CMC U releases 1 μmol of reducing sugars (expressed as glucose equivalents) in one minute under specific test conditions of 50°C and pH 4.8. It will be readily understood by one of skill in the art that pNPG U refers to units of pNPG. An activity pNPG U releases 1 μmol of nitrophenol per minute of para-nitrophenyl-B-D-glucopyranoside at 50 °C and pH 4.8. It will be readily understood by one of skill in the art that FPU of "filter paper units" provides a measure of cellulase activity. As used herein, FPU refers to units of filter paper as determined by the method of Adney, B. and Baker, J., Laboratory Analytical Procedure No. 006, “Measurement of cellulase activity”, August 12, 1996 , the US National Renewable Energy Laboratory (NREL), which is expressly incorporated by reference into this document in its entirety.
[077] In practicing the embodiments of the invention, it may be advantageous to adjust the temperature of the MSW before the initiation of enzymatic hydrolysis. As is well known in the art, cellulases and other enzymes typically exhibit an ideal temperature range. While examples of enzymes isolated from extreme thermophilic organisms are certainly known, having ideal temperatures in the order of 60 or even 70 °C, the ideal enzyme temperature ranges are typically in the range of 35 to 55 degrees. In some embodiments, enzymatic hydrolysis is conducted within the temperature range of 30 to 35 °C or 35 to 40 °C or 40 to 45 °C or 45 to 50 °C or 50 to 55 °C or 55 to 60 °C or 60 to 65 °C or 65 to 70 °C or 70 to 75 °C. In some embodiments, it is advantageous to conduct enzymatic hydrolysis and concomitant microbial fermentation at a temperature of at least 45°C, because this is advantageous in discouraging the proliferation of MSW-generated pathogens. See, for example, Hartmann and Ahring 2006; Deportes et al. 1998; Carrington et al. 1998; Bendixen et al. 1994; Kubler et al. 1994; Six and De Baerre et al. 1992.
[078] Enzymatic hydrolysis using cellulase activity will typically hydrolyze the cellulosic material. Consequently, during enzymatic hydrolysis, solid waste is either hydrolyzed or liquefied, that is, converted from a solid form to a liquid slurry.
[079] Previously, methods to process MSW using enzymatic hydrolysis to achieve liquefaction of biogenic components predicted a need to heat MSW to a temperature considerably higher than that required for enzymatic hydrolysis, specifically to achieve “sterilization ” of the residue, followed by a necessary cooling step to bring the heated residue back to an appropriate temperature for enzymatic hydrolysis. In practicing the methods of the invention, it is sufficient that the MSW is simply brought to an appropriate temperature for enzymatic hydrolysis. In some embodiments, it may be advantageous to simply adjust the MSW to an appropriate non-aqueous content using heated water, administered in such a way as to bring the MSW to an appropriate temperature for enzymatic hydrolysis. In some embodiments, the MSW is heated, either by adding heated aqueous content or steam, or by heating within a reactor vessel. In some embodiments, the MSW is heated inside a reactor vessel at a temperature greater than 30 °C, more less than 85 °C, or at a temperature of 84 °C or less, or at a temperature of 80 °C or less or at a temperature of 75 °C or less or at a temperature of 70 °C or less or at a temperature of 65 °C or less or at a temperature of 60 °C or less or at a temperature of 59 °C or less or at a temperature of 58 °C or less or at a temperature of 57 °C or less or at a temperature of 56 °C or less or at a temperature of 55 °C or less or at a temperature of 54 °C or at or below or at a temperature of 53 °C or less or at a temperature of 52 °C or less or at a temperature of 51 °C or less or at a temperature of 50 °C or less or at a temperature of 49 °C or less than or at a temperature of 48 °C or less or at a temperature of 47 °C or less or at a temperature of 46 °C or less or at a temperature of 45 °C or less. In some embodiments, the MSW is heated to a temperature no greater than 10°C above the highest temperature at which enzymatic hydrolysis is conducted.
[080] As used in this document, the MSW is “heated to a temperature” where the average temperature of the MSW is increased within a reactor to the temperature. As used herein, the temperature to which the MSW is heated is the highest average MSW temperature achieved within the reactor. In some embodiments, the highest average temperature may not be maintained for the entire period. In some embodiments, the heating reactor may comprise different zones so that heating occurs in stages at different temperatures. In some embodiments, heating can be achieved using the same reactor in which the enzymatic hydrolysis is conducted. The purpose of heating is simply to provide the majority of cellulosic residues and a substantial fraction of plant residues in an ideal condition for enzymatic hydrolysis. To be in an ideal condition for enzymatic hydrolysis, the residues should ideally have an appropriate temperature and aqueous content for the enzyme activities used for enzymatic hydrolysis.
[081] In some embodiments, it may be advantageous to stir during heating in order to reach an equally heated residue. In some embodiments, agitation may comprise free-fall mixing, such as mixing in a reactor that has a chamber that rotates along a substantially horizontal axis or in a mixer that has a rotary axis that lifts the MSW or in a mixer that has horizontal paddles or rods that lift the MSW. In some embodiments, agitation can comprise vibrating, mixing, or driving through a helical transport conductor. In some embodiments, stirring is continued after the MSW has been heated to the desired temperature. In some embodiments, agitation is conducted for between 1 and 5 minutes or between 5 and 10 minutes or between 10 and 15 minutes or between 15 and 20 minutes or between 20 and 25 minutes or between 25 and 30 minutes or between 30 and 35 minutes or between 35 and 40 minutes or between 40 and 45 minutes or between 45 and 50 minutes or between 50 and 55 minutes or between 55 and 60 minutes or between 60 and 120 minutes.
[082] Enzyme hydrolysis is initiated at that point where isolated enzyme preparations are added. Alternatively, in the case where isolated enzyme preparations are not added, but instead microorganisms exhibiting desired extracellular enzyme activities are used, enzymatic hydrolysis is initiated at that point where the desired microorganism is added.
[083] In practice of some embodiments, enzymatic hydrolysis is conducted concurrently with microbial fermentation. Concomitant microbial fermentation can be achieved using a variety of different methods. In some embodiments, microorganisms naturally present in MSW are simply allowed to grow under reaction conditions where the processed MSW has not previously been heated to a temperature that is sufficient to effect a "sterilization." Typically, the microorganisms present in the MSW will include organisms that are adapted to the local environment. The overall beneficial effect of concomitant microbial fermentation is comparatively robust, meaning that a very wide range of different organisms can, individually or collectively, contribute to organic capture through enzymatic hydrolysis of MSW. Without being bound by theory, it is considered that co-fermentation microbes individually have some direct effect on the degradation of food residues that are not necessarily hydrolyzed by cellulase enzymes. At the same time, the carbohydrate monomers and oligomers released by cellulase hydrolysis, in particular, are readily consumed by virtually any microbial species. This generates a beneficial synergy with cellulase enzymes, possibly through the release of product inhibition of enzyme activities and also possibly for other reasons that are not immediately apparent. The end products of microbial metabolism in any case are typically suitable for biomethane substrates. Enrichment of the enzymatically hydrolyzed MSW in microbial metabolites is thus in itself an improvement in the quality of the resulting biomethane substrate. Lactic acid bacteria, in particular, are abundant in nature and lactic acid production is typically observed when MSW is enzymatically hydrolyzed to a non-aqueous content between 10 and 45% within the temperature range of 45 to 50. At higher temperatures , possibly other species of naturally occurring microorganisms may predominate and other microbial metabolites other than lactic acid may become more prevalent.
[084] In some embodiments, microbial fermentation can be accomplished by a direct inoculation with the use of one or more microbial species. It will be readily understood by one of skill in the art that one or more bacterial species used for inoculation in order to provide simultaneous enzymatic hydrolysis and fermentation of MSW can be advantageously selected where the bacterial species can develop a temperature at or near the ideal for the enzymatic activities used.
[085] The inoculation of the hydrolysis mixture in order to induce microbial fermentation can be carried out by a variety of different means.
[086] In some embodiments, it may be advantageous to inoculate MSW either before, after or concurrently with the addition of enzymatic activities or with the addition of microorganisms that exhibit extracellular cellulase activity. In some embodiments, it may be advantageous to inoculate using one or more LAB species including but not limited to any one or more of the following, or genetically modified variants thereof: Lactobacillus plantarum, Streptococcus lactis, Lactobacillus casei, Lactobacillus lactis, Lactobacillus curvatus, Lactobacillus sake, Lactobacillus helveticus, Lactobacillus jugurti, Lactobacillus fermentum, Lactobacillus carnis, Lactobacillus piscicola, Lactobacillus coryniformis, Lactobacillus rhamnosus, Lactobacillus maltaromicus, Lactobacillus pseudoplantarum, Lactobacillus amminos, Lactobacillus amminosi, Lactobacillus ammniformis, Lactobacillus aniformis, Lactobacillus aniformis , Lactobacillus sharpeae, Lactobacillus divergens, Lactobacillus alactosus, Lactobacillus paracasei, Lactobacillus homohiochii, Lactobacillus sanfrancisco, Lactobacillus fructivorans, Lactobacillus brevis, Lactobacillus ponti, Lactobacillus reuteri, Lactobacillu s buchneri, Lactobacillus viridescens, Lactobacillus confusus, Lactobacillus minor, Lactobacillus kandleri, Lactobacillus halotolerans, Lactobacillus hilgardi, Lactobacillus kefir, Lactobacillus collinoides, Lactobacillus vaccinostericus, Lactobacillus delbacillus Labacillus labacillus, Labacillus acidillus Labacillus, Labacillus acidillus, Labacillus acidius, Labacillus acid , suebicus Lactobacillus actobacillus oris, Lactobacillus brevis, vaginalis, Lactobacillus pentosus Lactobacillus panis Lactobacillus, Lactococcus cremoris, Lactococcus dextranicum, Lactococcus garvieae, Lactococcus hordniae, Lactococcus raffinolactis, Streptococcus diacetylactis, Leuconostoc mesenteroides, Leuconostoc dextranicum, cremoris, Leuconostoc, oenos, Leuconostoc, Leuconostoc paramesenteroids, Leuconostoc pseudoesenteroides, Leuconostoc citreum, Leuconostoc gelidum, Leuconostoc carnosum, Pediococcus damnosus, Pediococcus acidilactici, Pediococcus cervisiae, Pediococ cus parvulus, Pediococcus halophilus, Pediococcus pentosaceus, Pediococcus intermedius, Bifidobacterium longum, Streptococcus thermophilus, Oenococcus oeni, Bifidobacterium breve, and Propionibacterium freudenreichii, or with some subsequently discovered species of LAB or with other species of the genera Lacctococcus, Enterococcus Pediococcus, or Carnobacterium that exhibit useful capacity for metabolic processes that produce lactic acid.
[087] It will be readily understood by one of skill in the art that a bacterial preparation used for inoculation may comprise a community of different organisms. In some embodiments, naturally occurring bacteria that exist in any given geographic region and that are adapted to live in the MSWs of that region can be used. As is well known in the art, LABs are ubiquitous and will typically comprise a major component of any naturally occurring bacterial community within MSWs.
[088] In some embodiments, MSW can be inoculated with naturally occurring bacteria, by continued recycling of wash water or process solutions used to recover residual organic material from non-degradable solids. As wash water or process solutions are recycled, they gradually acquire higher microbial levels. In some embodiments, microbial fermentation has a pH lowering effect, especially when metabolites comprise short chain fatty acids/carboxylic acids such as formate, acetate, butyrate, propionate or lactate. Accordingly, in some embodiments, it may be advantageous to monitor and adjust pH of the microbial fermentation mixture and the accompanying enzymatic hydrolysis. When wash waters or process solutions are used to increase the water content of incoming MSW prior to enzymatic hydrolysis, inoculation is advantageously carried out prior to the addition of enzymatic activities, either as isolated enzyme preparations or as microorganisms exhibiting activity of extracellular cellulase. In some embodiments, naturally occurring bacteria adapted to live in MSW of a particular region can be grown in MSW or in a liquefied organic component obtained by enzymatic hydrolysis of MSW. In some embodiments, cultivated naturally occurring bacteria can then be added as an inoculum, either separately or supplemental to the inoculation using recycled process solutions or wash waters. In some embodiments, bacterial preparations may be added prior to or concurrently with the addition of single enzyme preparations, or after some initial period of prehydrolysis.
[089] In some embodiments, specific strains can be grown for inoculation, including strains that have been specially modified or "trained" to live under enzymatic hydrolysis reaction conditions and/or to emphasize or de-emphasize particular metabolic processes. In some embodiments, it may be advantageous to inoculate MSW using bacterial strains that have been identified as having the ability to survive on phthalates as the sole carbon source. Such strains include but are not limited to any one or more of the following, or genetically modified variants thereof: Chryseomicrobium intechense MW10T, Lysinibaccillus fusiformis NBRC 157175, Tropicibacter phthalicus, Gordonia JDC-2, Arthrbobacter JDC-32, Bacillus subtilis 3C3, Comamonas testosteronii, Comamonas sp E6, Delftia tsuruhatensis, Rhodoccoccus jostii, Burkholderia cepacia, Mycobacterium vanbaalenii, Arthobacter keyseri, Bacillus sb 007, Arthobacter sp. PNPX-4-2, Gordonia namibiensis, Rhodococcus phenolicus, Pseudomonas sp. PGB2, Pseudomonas sp. Q3, Pseudomonas sp. 1131, Pseudomonas sp. CAT1-8, Pseudomonas sp. Nitroreducens, Arthobacter sp AD38, Gordonia sp CNJ863, Gordonia rubripertinctus, Arthobacter oxydans, Acinetobacter genomosp, and Acinetobacter calcoaceticus. See, for example, Fukuhura et al 2012; Iwaki et al. 2012A; Iwaki et al. 2012B; Latorre et al. 2012; Liang et al. 2010; Liang et al. 2008; Navacharoen et al. 2011; Park et al. 2009; Wu et al. 2010; Wu et al. 2011. Phthalates, which are used as plasticizers in many commercial polyvinyl chloride preparations, are leachable and, in the experience of the present inventors, are often present in the liquefied organic component at levels that are undesirable. In some embodiments, strains that have been genetically modified by methods well known in the art can be advantageously used for the purpose of emphasizing metabolic processes and/or de-emphasizing other metabolic processes including but not limited to processes that consume glucose, xylose or arabinose.
[090] In some embodiments, it may be advantageous to inoculate MSW with the use of bacterial strains that have been identified as having the ability to degrade lignin. Such strains include but are not limited to any one or more of the following, or genetically modified variants thereof: Comamonas sp B-9, Citrobacter freundii, Citrobacter sp FJ581023, Pandorea norimbergensis, Amycolatopsis sp ATCC 39116, Streptomyces viridosporous, Rhodococcus jostii, and Sphingobium sp. SYK-6. See for example, Bandounas et al. 2011; Bugg et al. 2011; Chandra et al. 2011; Chen et al. 2012; Davis et al. 2012. In the present inventors' experience, MSW typically comprise a considerable content of lignin, which is typically recovered as undigested residue after AD.
[091] In some embodiments, it may be advantageous to inoculate MSW using an acetate-producing bacterial strain, including but not limited to any one or more of the following, or genetically modified variants thereof: Acetitomaculum ruminis, Anaerostipes caccae, Acetoanaerobium noterae, Acetobacterium carbinolicum, Acetobacterium wieringae, Acetobacterium woodii, Acetogenium kivui, Acidaminococcus fermentans, Anaerovibrio lipolytica, Bacteroides coprosuis, Bacteroides propionicifaciens, Bacteroides celulosolvens, Bacteroides xylanolyticus, Bifidobacterium Bifidobacterium Bifidobacterium, Bifidobacterium Bifidobacterium infantis, Bifidobacterium longum, Bifidobacterium pseudolongum, Butirivibrio fibrisolvens, Clostridium aceticum, Clostridium acetobutilicum, Clostridium acidurici, Clostridium bifermentans, Clostridium botulinum, Clostridium butiricium, Clostridium cellobiopa rum, Clostridium formicaceticum, Clostridium histolyticum, Clostridium lochheadii, Clostridium methylpentosum, Clostridium pasteurianum, Clostridium perfringens, Clostridium propionicum, Clostridium putrefaciens, Clostridium sporogenes, Clostridium sporogenes, E. Eubacterium ruminantium, Fibrobacter succinogenes, Lachnospira multiparus, Megasphaera elsdenii, thermoacetica Moorella, acetylenicus Pelobacter, Pelobacter acidigallici, Pelobacter massiliensis, Prevotella ruminocola, Propionibacterium freudenreichii, flavefaciens Ruminococcus, Ruminobacter amylophilus albus Ruminococcus, Ruminococcus bromii, champanellensis Ruminococcus, Selenomonas ruminantium, Sporomusa paucivorans , Succinimonas amylolytica, Succinivibrio dextrinosolven, Syntrophomonas wolfei, Syntrophus aciditrophicus, Syntrophus gentianae, Treponema bryantii and Treponema primitia.
[092] In some embodiments, it may be advantageous to inoculate MSW with the use of a bacterial strain that produces butyrate, including but not limited to any one or more of the following, or genetically modified variants thereof: Acidaminococcus fermentans, Anaerostipes caccae, Bifidobacterium adolescentis, Butirivibrio crossotus, fibrisolvens Butirivibrio, Butirivibrio hungatei, Clostridium acetobutilicum, Clostridium aurantibutiricum, Clostridium beijerinckii, Clostridium butiricium, Clostridium cellobioparum, Clostridium difficile, Clostridium innocuum, Clostridium kluyveri, Clostridium pasteurianum, Clostridium perfringens, Clostridium proteoclasticum, Clostridium sporosphaeroides, Clostridium symbiosum, Clostridium tertium, Clostridium tyrobutiricum, Coprococcus eutactus, Coprococcus comes, Escherichia coli, Eubacterium barkeri, Eubacterium biform, Eubacterium celulosolvens, Eubacterium cylindroids, Eubacterium dolichum, Eubacterium hadrum, Eubacterium halii, Eubacterium limosum, Eubacterium moniliforme, Eubacterium oxidoreducens, Eubacterium ramulus, Eubacterium rectale, Eubacterium saburreum, Eubacterium tortuosum, Eubacterium ventriosum, Faecalibacterium prausnitzii, Fusobacterium prausnitzii, Peptostreptominiccoccus vaginalis, Peptostreptoccoccus tetrasiriria, Rosebusiris intestinal Peptostreptoccoccus tetrasiriobutdius intestinal Peptostreptoccoccus tetrabudius rudius intestinal Ruminococcus bromii.
[093] In some embodiments, it may be advantageous to inoculate MSW with the use of a bacterial strain that produces propionate, including but not limited to any one or more of the following, or genetically modified variants thereof: Anaerovbrio lipolytica, Bacteroides coprosuis, Bacteroides propionicifaciens, Bifidobacterium adolescentis, Clostridium acetobutilicum, Clostridium butiricium, Clostridium methylpentosum, Clostridium pasteurianum, Clostridium perfringens, Clostridium propionicum, Escherichia coli, Fusobacterium nucleatum, Megasphaera elsdenii, Prevotella ruminocola, Propionibacterium freudenreichii, Ruminococcus bromii, champanellensis Ruminococcus, Selenomonas ruminantium and Syntrophomonas wolfei.
[094] In some embodiments, it may be advantageous to inoculate MSW using an ethanol-producing bacterial strain, including but not limited to any one or more of the following, or genetically modified variants thereof: Acetobacterium carbinolicum, Acetobacterium wieringae, Acetobacterium woodii, Bacteroides celulosolvens, xylanolyticus Bacteroides, Clostridium acetobutilicum, Clostridium beijerinckii, Clostridium butiricium, Clostridium cellobioparum, Clostridium lochheadii, Clostridium pasteurianum, Clostridium perfringens, Clostridium thermocelum, Clostridium thermohydrosulfuricum, Clostridium thermosaccharolyticum, aerogenes Enterobacter, Escherichia coli, Klebsiella oxytoca, Klebsiella pneumonia Lachnospira multiparus, Lactobacillus brevis, Leuconostoc mesenteroides, Paenibacillus macerans, Pelobacter acetylenicus, Ruminococcus albus, Thermoanaerobacter mathranii, Treponema bryantii and Zymomonas mobilis.
[095] In some embodiments, a consortium of different microbes, optionally including different species of bacteria and/or fungi, can be used to achieve concurrent microbial fermentation. In some embodiments, suitable microorganisms can be selected for the purpose of providing a desired metabolic result under the intended reaction conditions and then inoculated at a high dose level for the purpose of overcoming naturally occurring strains. For example, in some embodiments, it may be advantageous to inoculate using a homofermentative lactate producer as this provides a higher eventual methane potential in a resulting biomethane substrate than can be provided by a heterofermentative lactate producer. ..
[096] In some embodiments, the invention provides a method of processing municipal solid waste (MSW) comprising the steps of (i) . provision of MSW at a non-aqueous content between 5 and 40% and at a temperature within the range 35 and 75 °C, (ii) . submit the biodegradable parts of MSW to microbial fermentation and enzymatic hydrolysis at a temperature within the range 35 and 75 °C resulting in partial liquefaction of biodegradable parts of the residue and accumulation of microbial metabolites, followed by (iii) . separating the liquefied, biodegradable parts from the residue of non-biodegradable solids to produce a biodegradable slurry characterized by comprising dissolved volatile solids of which at least 25% by weight comprise any combination of acetate, butyrate, ethanol, formate, lactate and/or propionate, optionally followed by (iv) . anaerobic digestion of the bioliquid to produce biomethane.
[097] After some period of enzymatic hydrolysis and concomitant microbial fermentation, MSW provided at a non-aqueous content between 10 and 45% is transformed so that biogenic or “fermentable” components become liquefied and microbial metabolites accumulate in the aqueous phase. After some period of enzymatic hydrolysis and concomitant microbial fermentation, the liquefied, fermentable parts of the residue are separated from non-fermentable solids. The liquefied material, once separated from the non-fermentable solids, is what is called “biodegradable fluid paste”. In some embodiments, at least 40% of the non-aqueous content of such biodegradable slurry comprises dissolved volatile solids, or at least 35%, or at least 30%, or at least 25%. In some embodiments, at least 25% by weight of the volatile solids dissolved in the biodegradable slurry comprises any combination of acetate, butyrate, ethanol, formate, lactate, and/or propionate, or at least 30%, or at least 35% or at least minus 40%. In some embodiments, at least 70% by weight of the dissolved volatile solids comprises lactate, or at least 60%, or at least 50%, or at least 40%, or at least 30%, or at least 25%.
[098] In some embodiments, the separation of non-fermentable solids from liquefied, degradable parts of the MSW so as to produce a biodegradable slurry characterized by comprising dissolved volatile solids of which at least 25% by weight comprises any combination of acetate, butyrate , ethanol, formate, lactate and/or propionate is conducted in less than 16 hours after the start of enzymatic hydrolysis, or in less than 18 hours, or less than 20 hours, or in less than 22 hours, or in less than 24 hours , or in less than 30 hours, or in less than 34 hours, or in less than 36 hours, or between 36 and 48 hours, or between 48 and 60 hours, or between 60 and 72 hours.
[099] The separation of liquefied, degradable parts from the residue from non-degradable solids can be achieved by a variety of means. In some embodiments, this can be achieved using any combination of at least two different separation operations, including, but not limited to, screw press operations, ballistic separator operations, vibrating sieve operations, or other separation operations known in the art. In some embodiments, the non-degradable solids separated from biodegradable portions of the waste comprise on average at least about 20% of the dry weight of the processed MSW, or at least 25%, or at least 30%. In some embodiments, the non-degradable solids separated from degradable portions of the processed waste comprise on average at least 20% dry weight of recyclable materials, or at least 25%, or at least 30%, or at least 35%. In some embodiments, separation using at least two separation steps produces a biodegradable slurry that comprises at least 0.15 kg of volatile solids per kg of MSW processed, or at least 0.10. It will be readily understood by one skilled in the art that the inherent biogenic composition of MSW is variable. Nevertheless, the figure of 0.15 kg volatile solids per kg processed MSW reflects a total capture of biogenic material in typical unsorted MSW of at least 80% dry weight. The calculation of kg of volatile solids captured in the biodegradable slurry per kg of processed MSW can be estimated over a period of time in which the total yields and total processed MSW are determined. For a given period, the average production of biogenic slurry obtained can be calculated =kg slurry/H; mean MSW production is calculated =kg MSW/H; the average VS content of the slurry is analyzed and the result expressed as VS% of total mass; kg of VS is calculated as kg of slurry/H * VS% = kg of VS/H
[0100] So, kg of VS/H/kg of MSW/H = kg of VS/kg of MSW.
[0101] In some embodiments, after the separation of non-degradable solids from liquefied, fermentable parts of the MSW is achieved to produce a biodegradable slurry, the slurry can be subjected to post-fermentation under different conditions, including different temperature or pH.
[0102] The term "dissolved volatile solids" as used herein refers to a simple measurement calculated as follows: The biodegradable slurry sample is centrifuged at 6900 g for 10 minutes in a 50 ml Falcon tube to produce a pellet and a supernatant. The supernatant is decanted and the net weight of the pellet expressed as a fraction of a percentage of the total initial weight of the liquid sample. The supernatant sample is dried at 60 degrees for 48 hours to determine dry matter content. The volatile solids content of the sample supernatant sample is determined by subtracting from the dry matter measurement the ash remaining after furnace firing at 550 °C and expressed as a percentage by mass as volatile dissolved solids in %. The dry matter content of the pellet is determined by drying at 60 °C for 48 hours. The liquid part of the pellet being (1-pellet dry matter) is expressed as a percentage of pellet mass. The composition of the liquid part of the pellet is estimated to be similar to the supernatant. Thus, the total volatile dissolved solids of the sample is the sum of the volatile dissolved solids of the supernatant and the (mass percentage of the liquid part of the pellet) x (the volatile dissolved solid of the supernatant).
[0103] In some embodiments, the invention provides compositions and methods for producing biomethane. The foregoing detailed discussion regarding the embodiments of MSW processing methods, including details regarding the compositional aspects of the obtained biodegradable slurry, can optionally be applied to the embodiments that provide methods and compositions for biomethane production. In some embodiments, any of the details regarding the compositional aspects of the biodegradable slurry can be obtained by a process in which unsorted MSW subjected to microbial fermentation is subjected to separation of non-degradable solids to produce a biodegradable slurry, such slurry is , then subjected to continued fermentation at a temperature within the range of 35 to 75 °C, or between 40 and 55 °C, or between 45 and 50 °C, at a pH within the range 4.2 to 6.0 per a time between 1 and 72 hours. In some embodiments, such continued fermentation is supplemented in which biodegradable material recovered by sieves or other systems, as the material was not technically part of the initially recovered biodegradable slurry, can be added to the slurry.
[0104] The metabolic dynamics of microbial communities engaged in anaerobic digestion are complex. See Supaphol et al. 2010; Morita and Sasaki 2012; Chandra et al. 2012. In the typical anaerobic digestion (AD) for the production of methane biogas, the biological processes mediated by microorganisms reach four primary steps - hydrolysis of biological macromolecules into constituent monomers or other metabolites; acidogenesis, through which alcohols and short-chain hydrocarbon acids are produced; acetogenesis, through which available nutrients are catabolized into acetic acid, hydrogen and carbon dioxide; and methanogenesis, through which acetic acid and hydrogen are catabolized by archaebacteria specialized in methane and carbon dioxide. The hydrolysis step is typically rate limiting. See, for example, Delgenes et al. 2000; Angelidaki et al. 2006; Cysneiros et al. 2011.
[0105] Consequently, it is advantageous in the preparation of substrates for the production of biomethane that these are hydrolyzed beforehand through some form of pre-treatment. In some embodiments, the methods of the invention combine microbial fermentation with enzymatic MSW hydrolysis as both a rapid biological pretreatment for the production of eventual biomethane as well as a method for separating degradable organic components from unseparated MSW.
[0106] Biological pretreatments have been reported using solid biomethane substrates including the source-separated organic component of MSW. See, for example, Fdez-Guelfo et al. 2012; Fdez-Guelfo et al. 2011 A; Fdez-Guelfo et al. 2011 B; Ge et al. 2010; Lv et al. 2010; Borghi et al. 1999. Improvements in eventual methane yields from anaerobic digestion have been reported as a consequence of increased degradation of complex biopolymers and increased solubilization of volatile solids. However, the level of solubilization of volatile solids and the level of conversion of volatile fatty acids achieved by these previously reported methods do not even approach the levels achieved by the methods of the invention. For example, Fdez-Guelfo et al. 2011 A reports a 10 to 50% relative improvement in volatile solids solubilization achieved through various biological pretreatments of the pre-separated organic fraction of MSW - this corresponds to final absolute levels of solubilization between about 7 to 10% solids. volatiles. In contrast, the methods of the invention produce liquid biomethane substrates that comprise at least 40% volatile dissolved solids.
[0107] Two-stage anaerobic digestion systems have also been reported in which the first-stage process hydrolyses biomethane substrates including the source-separated organic component of MSW and other specialized biogenic substrates. During the first anaerobic stage, which is typically thermophilic, upper-chain polymers are degraded and volatile fatty acids are produced. This is followed by a second anaerobic stage conducted in a physically separate reactor in which methanogenesis and acetogenesis dominate. The reported two-stage anaerobic digestion systems typically utilized specialized source-separated biogenic substrates that have less than 7% total solids. See, for example, Supaphol et al. 2011; Kim et al. 2011; Lv et al. 2010; Riau et al. 2010; Kim et al. 2004; Schmit and Ellis 2000; Lafitte-Trouque and Forster 2000; Dugba and Zhang 1999; Kaiser et al. 1995; Harris and Dague 1993. More recently, some two-stage AD systems have been reported to utilize specialized source-separated biogenic substrates at levels as high as 10% total solids. See, for example, Yu et al. 2012; Lee et al. 2010; Zhang et al.2007. Of course, none of the reported two-stage anaerobic digestion systems have ever contemplated the use of unseparated MSW as a substrate, let alone in order to produce a high solids liquid biomethane substrate. Two-stage anaerobic digestion seeks to convert solid substrates, continuously feeding additional solids to and continuously removing volatile fatty acids from the first-stage reactor.
[0108] In some embodiments, the biomethane production method comprises the steps of (i). provision of a liquid biomethane substrate preconditioned by microbial fermentation such that at least 40% by weight of the non-aqueous content exists as volatile dissolved solids, such volatile dissolved solids comprise at least 25% by weight of any combination of acetate, butyrate, ethanol , formate, lactate and/or propionate, (ii). transfer of liquid substrate to an anaerobic digestion system, followed by (iii). conduction of anaerobic digestion of the liquid substrate to produce biomethane.
[0109] In some embodiments, the invention provides a liquid biomethane substrate produced by enzymatic hydrolysis and microbial fermentation of municipal solid waste (MSW), or pretreated lignocellulosic biomass, alternatively comprises microbially fermented and enzymatically hydrolyzed MSW, or comprises microbially fermented and enzymatically hydrolyzed pretreated lignocellulosic biomass characterized in that - at least 40% by weight of the non-aqueous content exists as dissolved volatile solids, such dissolved volatile solids comprise at least 25% by weight of any combination of acetate, butyrate, ethanol , formate, lactate and/or propionate.
[0110] In some embodiments, the invention provides an organic liquid biogas substrate produced by enzymatic hydrolysis and microbial fermentation of municipal solid waste (MSW), characterized in that - at least 40% by weight of the non-aqueous content exists as dissolved volatile solids such volatile dissolved solids comprise at least 25% by weight of any combination of acetate, butyrate, ethanol, formate, lactate and/or propionate.
[0111] In some embodiments, the invention provides a method for producing biogas comprising the steps of (i) . provision of an organic liquid biogas preconditioned by the microbial fermentation such that at least 40% by weight of the non-aqueous content exists as dissolved volatile solids, such dissolved volatile solids comprise at least 25% by weight of any combination of acetate, butyrate, ethanol , formate, lactate and/or propionate, (ii) . transfer of liquid substrate into an anaerobic digestion system, followed by (iii) . conduction of anaerobic digestion of the liquid substrate to produce biomethane.
[0112] As used herein, the term "anaerobic digestion system" refers to a fermentation system comprising one or more reactors operated under controlled aeration conditions in which methane gas is produced in each of the reactors comprising the system. Methane gas is produced to the point where the metabolically generated dissolved methane concentration in the aqueous phase of the fermentation mixture within the “anaerobic digestion system” is saturated under the conditions used and methane gas is emitted from the system.
[0113] In some embodiments, the "anaerobic digestion system" is a fixed filter system. An "anaerobic digestion fixed filter system" refers to a system in which an anaerobic digestion consortium is immobilized, optionally on a biofilm, on a physical support matrix.
[0114] In some embodiments, the liquid biomethane substrate comprises at least 8% total solids, or at least 9% total solids, or at least 10% total solids, or at least 11% total solids, or at least minus 12% total solids, or at least 13% total solids. "Total solids" as used herein refers to both soluble and insoluble solids and effectively means "non-aqueous content." Total solids are measured by drying at 60°C until a constant weight is reached.
[0115] In some embodiments, microbial fermentation is conducted under conditions that discourage methane production by methanogens, for example, at pH less than 6.0, or at pH less than 5.8, or at pH less than 5, 6, or at pH less than 5.5. In some embodiments, the liquid biomethane substrate comprises less than dissolved methane saturation conditions. In some embodiments, the liquid biomethane substrate comprises less than 15 mg/l dissolved methane, or less than 10 mg/l, or less than 5 mg/l.
[0116] In some embodiments, prior to anaerobic digestion to produce biomethane, one or more components of the dissolved volatile solids can be removed from the liquid biomethane substrate by distillation, filtration, electrodialysis, specific binding, precipitation, or other means well known in the art. In some embodiments, ethanol or lactate can be removed from the liquid biomethane substrate prior to anaerobic digestion to produce biomethane.
[0117] In some embodiments, a solid substrate such as MSW or fiber fraction of pretreated lignocellulosic biomass is subjected to enzymatic hydrolysis concurrently with microbial fermentation in order to produce a liquid biomethane substrate preconditioned by microbial fermentation so that at least at least 40% by weight of the non-aqueous content exists as volatile dissolved solids, such volatile dissolved solids comprise at least 25% by weight of any combination of acetate, butyrate, ethanol, formate, lactate and/or propionate. In some embodiments, a liquid biomethane substrate having the above-mentioned properties is produced by microbial fermentation and concomitant enzymatic hydrolysis of liquefied organic material obtained from non-separated MSWs by an autoclave process. In some embodiments, the pretreated lignocellulosic biomass can be blended with microbially fermented and enzymatically hydrolyzed MSW, optionally in such a way that the enzymatic activity of the MSW-derived bioliquid provides the enzymatic activity for hydrolysis of the lignocellulosic substrate to produce a biomethane substrate composite liquid derived from both MSW and pretreated lignocellulosic biomass.
[0118] "Soft lignocellulosic biomass" refers to plant biomass other than wood that comprises cellulose, hemicellulose and lignin. Any suitable soft lignocellulosic biomass can be used, including biomass such as at least wheat straw, corn husk, corn cobs, empty fruit bunches, rice straw, oat straw, barley straw, canola straw, canola straw. rye, sorghum, sweet sorghum, soybean straw, yellow millet, Bermuda grass and other grasses, bagasse, beet pulp, corn fiber, or any combinations thereof. Lignocellulosic biomass can comprise other lignocellulosic materials such as paper, newsprint, cardboard, or other urban or office waste. Lignocellulosic biomass can be used as a mixture of materials from different raw materials, it can be fresh, partially dried, totally dry or any combination thereof. In some embodiments, the methods of the invention are practiced using at least about 10 kg of biomass feedstock, or at least 100 kg, or at least 500 kg.
[0119] Lignocellulosic biomass must generally be pretreated by methods known in the art before conducting enzymatic hydrolysis and microbial preconditioning. In some embodiments, biomass is pretreated by hydrothermal pretreatment. "Hydrothermal pretreatment" refers to the use of water, either as a hot liquid, water vapor or pressurized steam comprising high temperature steam or liquid or both, to "cook" biomass, at temperatures of 120 °C or more, either with or without the addition of acids or other chemicals. In some embodiments, lignocellulosic biomass feedstocks are pretreated by autohydrolysis. "Self-hydrolysis" refers to a pretreatment process in which the acetic acid released by hydrolysis of hemicellulose during pretreatment further catalyzes the hydrolysis of hemicellulose and applies to any hydrothermal pretreatment of lignocellulosic biomass conducted at pH between 3.5 and 9.0.
[0120] In some embodiments, hydrothermally pretreated lignocellulosic biomass can be separated into a liquid fraction and a solid fraction. “Solid fraction” and “liquid fraction” refer to the fractionation of pretreated biomass in solid/liquid separation. The separated liquid is collectively referred to as the "liquid fraction." The residual fraction that comprises a considerable content of insoluble solid is called "solid fraction". Either the solid fraction or the liquid fraction or both combined can be used to practice the methods of the invention or to produce compositions of the invention. In some embodiments, the solid fraction can be washed away. EXAMPLE1.BIODEGRADABLE CAPTURE IN A BIOGENIC FLUID PULP OBTAINED BY MICROBIAL HYDROLYSIS AND MSW FERMENTATION AND SUPPLEMENTARY CELL ACTIVITY ISOLATED ENZYME PREPARATIONS
[0121] Experiments were conducted at the REnescience demonstration plant located in Amager ressource center (ARC), Copenhagen, Denmark. A schematic drawing showing the main features of the plant is shown in Figure 4. The concept of the ARC REnescience Waste Refinery is to separate MSW into four products. A bioliquid for the production of biogas, inert materials (glass and sand) to recycle and 2D and 3D fractions of inorganic materials suitable for RDF production or metal, plastic and tree recycling.
[0122] MSW from urban areas is collected as is in plastic bags. The MSW is transported to the REnescience Waste Refinery where it is stored in a silo until processing. Depending on the character of the MSW, a separation step can be installed in front of the REnescience system to remove oversized particles (above 500 mm).
[0123] As shown in Figure 1, an unseparated MSW stream is heated and its non-aqueous content adjusted by the addition of heated aqueous solution. In previous embodiments of the REnescience process, we relied on cellulase activity provided by isolated enzyme preparations to facilitate rapid degradation of the biodegradable component. Previously, isolated enzyme preparations were added to the heated residue at a suitable non-aqueous content. The residue, with added enzymes, was then pre-incubated in a reactor called an "enzyme reactor" similar to that described in WO2011/032557, including a chamber that rotates on a substantially horizontal geometric axis, equipped with accessories on its surface which forms a spiral arrangement, which moves the MSW continuously from the inlet to the outlet end. Depending on the degree to which the reactor is filled, and depending on the reactor size, the average “residence time” of MSW within the reactor can be controlled. The reactor has been equipped with heating elements so that an adequate temperature can be maintained.
[0124] While continuously introducing MSW into the reactor and partially continuously removing degraded MSW from the reactor, a certain mean residence time is obtained. Partially degraded MSW removed from the reactor is. then subjected to two different separation steps. First, a ballistic separator having 40 mm sieves is applied to produce a biogenic slurry flow as well as a 3D nondegradable fraction and a 2D nondegradable fraction. Second, the 2D nondegradable fraction is further subjected to dehumidification using a helical press, with the recovery of additional biogenic slurry which is, in turn, mixed with the slurry obtained from the ballistic separator step.
[0125] The biogenic slurry obtained is then subjected to additional “fine” separation using two vibrating sieves, the first having 8 mm sieves, which separates mainly non-degradable contaminants. The second vibrating sieve, having 3mm sieves, typically separates larger fibers, which comprise a considerable amount of biodegradable material. After passing through the 3 mm sieve, the biogenic slurry obtained is stored in a large tank that is equipped with load cells, allowing an accurate record of the biogenic slurry mass obtained within a certain period of time.
[0126] The dehumidified solid 2D fraction is then subjected to a counter-current washing mechanism to clean the 2D fraction and also recover additional biodegradable material that would otherwise be lost - The dehumidified solid 2D fraction is, then subjected to a two-stage counter-current washing mechanism in drums to clean the 2D fraction and also recover additional biodegradable material that would otherwise be lost. Details are provided in Figure 1, which presents the water flows in the system. Fresh water is applied to wash 3D non-degradable material recovered from the ballistic separator in a simple drum. This wash water is then used as "clean" water which is fed to the second of the two identical wash units in order to provide backwash - the new "clean" water meets the "cleaner" waste while , consecutively, more dirty water is applied to the “dirtiest” incoming garbage. The washing mechanism works as follows: 2D dirt enters a drum in the first washing unit, where the residue is mixed with the back-flow washing water. Additionally, the dirty wash water is subjected to sieve filtration having sieves of 0.04 to 0.08 mm, to remove fibers, which typically comprise mainly biodegradable material. Sand and heavy material is also removed by sedimentation and a helical conductor at the bottom of each washing unit. The fraction removed is mainly sand/glass/hard plastic/and other inorganics. After the first washing, the residue is moved by a twist drill to a second washing unit, which is identical to the first one. The wash water from the first wash unit is typically between 1 - 4% by weight of TS, while the wash water from the second wash unit is typically 0.5 -3.0% by weight.
[0127] The wash waters, which comprise some biodegradable material recovered from the MSW, as well as the associated microorganisms, were then stored in a “buffer” tank. The aqueous solution from this “buffer” tank was then previously used to adjust the non-aqueous content of the incoming MSW. Previously, we typically first heat the “buffer” tank solution by applying steam, then mix the heated solution with input MSW in order to simultaneously heat to a suitable temperature and also adjust the non-aqueous content.
[0128] As explained in the examples presented subsequent to this example 1, we have previously determined that inoculation of the incoming MSW provided by the recirculated washing waters improved what we call biodegradable capture which is achieved with the assistance of enzymatic hydrolysis using preparations of isolated cellulase. By “biodegradable capture”, it means the mass of volatile solids that is captured in the biogenic slurry, which is typically expressed as kg of VS (volatile solids)/kg of processed MSW.
[0129] In this experiment, we sought to test how effective the biodegradable capture would be if we did not apply any isolated enzyme preparation, but instead simply applied an inoculum of microorganisms naturally present in MSW, to achieve rapid degradation by microbial hydrolysis and fermentation.
[0130] To this end, we adjust the "buffer" tank, from which recirculated wash water solution is collected to adjust the non-aqueous content of the incoming MSW, with a heat exchanger system, in order to be used as a fermenter that maintains a temperature of 45 °C to promote bacterial growth. The “buffer” tank is equipped with an efficient agitation system comprising a center mounted vertical axis fitted with two sets of fans included in the axis. The two sets of fans span two-thirds of the tank's diameter and are included at a shaft height corresponding to one-quarter the distance from the tank bottom and three-quarters the distance from the tank bottom. In order to avoid heating the “inoculum” collected from the buffer/fermentor tank so that it can heat the microorganisms, we used different procedures to heat the incoming MSW compared to the normal procedures used when applying isolated enzyme preparations.
[0131] The seventeen (17) day trial documented in this example was divided into five sections, as shown in Table 2. TABLE2.

[0132] Unseparated MSW obtained from Copenhagen, Denmark was continuously loaded at the REnescience demonstration plant. The isolated enzyme preparation used was a commercially available cellulase preparation optimized for lignocellulosic biomass conversion and provided by NOVOZYMES ™ under the trade name CELLIC CTEC 3 ™. For periods in which the isolated cellulase preparation was used, an amount corresponding to 9 g of enzyme preparation was added for each kg of input MSW (0.9% by weight).
[0133] The settings for the operation were as follows for both periods in which the isolated commercial enzyme preparation was added: - Introduced an inlet MSW flow to the enzyme reactor at the rate of 280 kg MSW/h - Adjusted the non-aqueous content of the incoming MSW stream by adding a recirculated wash water solution, which was stored in the buffer tank at room temperature, then heated to approximately 75 °C in the water heater at the rate of 560 L of water/ h - Introduced CTEC 3 ™ to the inlet MSW stream at 0.9% by weight corresponding to cellulase activity of approximately 670 FPU per L water content of wet MSW - Run the enzyme reactor in order to reach a time retention time of approximately 18 hours at approximately 50 °C, with pH adjusted using CaCO3 to within the pH range 4.5 - 5.
[0134] During the “maintenance” period, the reactor was stopped. At the end of this period, approximately 2000 kg of contents were removed from the enzyme reactor before proceeding with continuous operation in the “no enzyme” period.
[0135] The period referred to as “rise time” without enzymes refers to the period during which residual CTEC3 was removed from the system.
[0136] The settings for operation during the enzyme-free period (ie, for "rise time" and "microbial fermentation only") as follows: - Introduced an inlet MSW stream to the enzyme reactor/microbial fermenter at rate 130 kg MSW/h - Adjusted the non-aqueous content of the inlet MSW stream by the addition of an inoculum comprising a recirculated wash water solution collected from the buffer/fermentor tank, which was kept at 45 °C and stirred continuously using the agitator described above, running at about 30 rpm, and wherein substrates were added to promote bacterial growth and cellulase enzyme expression, including approximately 1% by weight of yeast extract, approximately 1% by weight of mixed glucose/sucrose, and approximately 1% by weight microcrystalline cellulose (trade name AVICEL™). This "inoculum" was collected through the water heater maintained at approximately 45 °C at the rate of 260 L of water/h - The enzyme reactor/microbial fermenter was run (NOTE explains the retention time), in order to achieve an average retention time of approximately 36 hours at approximately 45 °C, with pH adjusted using CaCO3 to within the range 4.5 - 5.
[0137] Samples were obtained at selected time points in the following places: - The biogenic slurry obtained after passing the 3 mm sieve sieve, which is called "EC12B" - Material retained by the 8 mm sieve - Material retained by the 3 mm sieve - Material retained by the Fiber 1 sieve applied to washing water - Material retained by the Fiber 2 sieve applied to washing water - Washing water sampled after cleaning the Fiber sieves - Non-degradable 2D fraction - Non-degradable 3D fraction degradable - Inert background fraction of both washing units
[0138] Biogenic slurry production was measured with load cells in the storage tank. The inflow of fresh water was measured with flow meters. The other fractions were weighed separately on a scale so that the total mass fluxes for any given period of time could be counted.
[0139] For the purpose of content analysis, samples were also obtained at selected time points from the EC12B, the buffer tank/fermenter, and the enzyme reactor/microbial fermentation reactor. These samples were boiled in order to interrupt the microbial and enzymatic activity.
[0140] Figure 2 shows the sum of microbial metabolites lactate, acetate and ethanol, expressed as a concentration in grams per liter, in biogenic slurry samples obtained at various points in time. As shown, during the first period with added cellulase activity, between hours 1 and 153, the level of microbial metabolites gradually rises until it becomes relatively stable at about 35 g/L. During the period with microbial fermentation only, between hours 250 and 319, the level of metabolites was somewhat lower, but stable at about 27-30 g/L. During the second period with added cellulase activity, between hours 319 and 390, the level of metabolites seems to be increased compared to the first period with added cellulase activity to between 35-40 g/L.
[0141] These results indicate, on the one hand, that it could be advantageous to include some supplemental cellulase activity with microbial fermentation. On the other hand, these results also indicate that the inoculum used was sufficient to promote rapid MSW degradation using only microbial fermentation.
[0142] Figure 3 shows the biodegradable capture in kg of TS (Total Solids)/kg of MSW for different periods of time. Typically, organic capture is determined in terms of volatile solids (VS). These samples were obtained and the results can be provided post-deposit. Here, the results are presented in terms of TS, which includes ash content.
[0143] Figure 3(A) shows the biodegradable capture in kg of TS/kg of MSW in biogenic slurry samples obtained after passing through the 3 mm sieve called "EC12B". For a given period, the average production of biogenic slurry obtained after passing through the 3 mm sieve called “EC12B” pe calculated = kg slurry/H; mean MSW production is calculated = kg MSW/H; the average SV content of the slurry is analyzed and the result expressed as % VS of the total mass; kg VS is calculated as kg slurry/H * % VS = kg VS/H
[0144] So, kg of VS/H/kg of MSW/H = kg of VS/kg of MSW. During the period with microbial fermentation only, between hours 250 and 319, the figures were corrected so as not to count the mass of special substrates added to the buffer/fermentor tank. As shown, during the first period with added cellulase activity, between hours 1 and 153, the level of biodegradable capture in the biogenic slurry obtained after the 3 mm sieve was about 0.21-0.25 kg of TS /kg of MSW. During the period with microbial fermentation only, between hours 250 and 319, the level of "organic capture" in the biogenic slurry obtained after the 3 mm sieve was clearly decreased to about 0.10 to 0.15 kg of TS/ kg of MSW. During the second period with added cellulase activity, between hours 319 and 390, the level of biodegradable capture in the biogenic slurry obtained after the 3 mm sieve was similar to that observed during the first period with added cellulase activity, at approximately from 0.21 - 0.25 kg of TS/kg of MSW.
[0145] Figure 3(B) shows the "total biodegradable capture" in kg of TS/kg of MSW, combining the TS obtained in the biogenic slurry samples obtained after passing through a 3 mm sieve called "EC12B" as well as the TS obtained in the fiber fractions retained by the 3 mm sieve and by the Fiber 1 and 2 sieves applied to the washing waters. During the period with microbial fermentation only, between hours 250 and 319, the figures were corrected so as not to count the mass of special substrates added to the buffer/fermentor tank. As shown, during the first period with added cellulase activity, between hours 1 and 153, the level of “total biodegradable capture” was only slightly higher than the level of biodegradable capture in the liquid. During the period with microbial fermentation only, between hours 250 and 319, the level of “full biodegradable capture” was much higher compared to liquid capture only, at levels approximately the same as those achieved with added cellulase activity. During the second period with added cellulase activity, between hours 319 and 390, the level of “full biodegradable capture” was similar to that observed during the first period with added cellulase activity.
[0146] These results indicate that, while the added cellulase activity clearly facilitates a more complete degradation of MSW during the short retention time before the separation of non-degradable solids, nevertheless, microbial fermentation alone can provide sufficient degradation of MSW during a similarly short retention time, so as to allow essentially equivalent “biodegradable capture” in biological separation of MSW.
[0147] This is particularly significant in that the biogenic slurry obtained using added commercial cellulase activity does not retain much activity after separation from non-degradable solids. This effect possibly arises in a substantially different way from cellulase catalysis in the case of activity secreted by living organisms in real life, compared to the activities of secreted, genetically engineered products that have been “grown” and provided as CTEC3™. In previous studies, at the demonstration plant, we examined the various fractions described above in order to identify the fact of added commercial cellulase activity. The levels of cellulase activity (FPU) observed in the biogenic slurry obtained after the 3 mm sieve called “EC12B” were typically less than 0.5% of those observed in the enzyme reactor before the separation of non-degradable materials.
[0148] In contrast, biogenic slurry obtained using only microbial fermentation can be expected to retain a very high level of microbially derived cellulase activity, as it retains a high level of living cells.
[0149] Similarly, unlike CTEC3™ dependent degradation, microbial fermentation allows for the simple feature of post-fermentation of the biogenic slurry, prior to biomethane production or other uses. In post-fermentation, “biodegradable capture” retained by the various sieves is mixed with biogenic slurry and allowed to continue to ferment at a suitable temperature.
[0150] Biogenic slurry samples obtained at selected time points during the microbial fermentation period were analyzed for dissolved solids. The volatile solids content of the supernatant sample was determined by subtracting from the dry matter measurement the ash remaining after furnace firing at 550 °C and expressed as a percentage by mass as volatile solids dissolved in %. The dry matter content of the pellet is determined by drying at 60 °C for 48 hours. The liquid part of the pellet being (1-pellet dry matter) expressed as a percentage of pellet mass. The composition of the liquid part of the pellet is estimated to be similar to the supernatant. Thus, the total volatile dissolved solids of the sample is the sum of the volatile dissolved solids of the supernatant and the (mass percentage of the liquid part of the pellet) x (the volatile dissolved solid of the supernatant).
[0151] Results of the analysis are presented in Table 3. Concentrations of lactate, acetate and ethanol are presented as % by weight overall. TABLE 3. BIOGENIC FLUID FLUID ANALYSIS

[0152] As shown, as a percentage of total volatile solids, the dissolved solids content of the biogenic slurry obtained using microbial fermentation alone was consistently between 40-50%. This indicates that microbial fermentation alone is sufficient to substantially degrade MSW, so as to make the biodegradable content susceptible to recovery from a biological separation operation, as described here. The slurry obtained, as described, was pumpable at all time periods during microbial fermentation. EXAMPLE 2. CHARACTERIZATION OF MICROBIALLY DERIVED CELLULASE ACTIVITY AND OTHER MSW DEGRADATION ACTIVITIES EXPRESSED BY MICROBIAL INOCULUM
[0153] During the test described in Example 1, a liquid sample from the buffer tank/fermentor tank (microbial inoculum) was removed at hour 245. While this sample was obtained slightly before the thorough washing of residual CTEC3 activity, the activity of Residual CTEC in the buffer/fermentor tank at this point may not have been greater than 8 FPU/L in a worst-case estimate. From the moment the sample was taken until the experiment started, 5.5 hours passed. 20ml of the microbial inoculum was added to 1g of dry substrate. The substrates were; 100% new paper pulp tissue paper (LOMELETTER™), the cellulosic fraction of model residue and complete model residue. Model waste was prepared using fresh production to understand the “organic” fraction (defined as the cellulosic, animal and vegetable fractions) of municipal solid waste (prepared as in Jensen et al., 2010 based on Riber et al. 2009) . Complete model residue composition was as follows:

[0154] The cellulosic fraction consists of cardboard (coated and uncoated), clean paper, advertisements, gift wrapping and more. The animal fraction consists of protein and fats from poultry, pork and meat. Vegetable fractions contain fruits, vegetables, and inedible parts such as green pea pod husks.
[0155] The model residue was stored in aliquots at -20 °C and melted overnight at 4 °C. The model residue has a dry matter content of 28.4% (3.52g of model residue was added to produce 1g of dry matter (DM)). In addition, for each type of substrate, CELLIC CTEC3 ™ (VDNI0009, NOVOZYMES A/S, Bagsvaerd, Denmark) (CTec3) was applied at a dosage of 32mg/g of dry matter on the substrates, to compare with the hydrolysis measure achieved by the microbial inoculum.
[0156] The cellulase activity of CTEC3 was previously measured by the method reported in Ghose, T.K., Measurement of cellulase activities. Pure & Appl. Chem., 1987. 59(2): p. 257-268, and found to be 179 FPU/g enzyme preparation. Likewise, the dose used in these experiments corresponds to approximately 5.7 FPU/g of DM or, expressed in terms of reaction volume, approximately 286 FPU/L.
[0157] To adjust and maintain the pH at 5 during the reaction with added CTEC3 a sodium acetate buffer (0.05M) was applied to bring the total volume to 20g. Each reaction was done in triplicate, and one reaction of each substrate was incubated in parallel with only one buffer added (white substrate).
[0158] Reactions were incubated for 24 hours in a Stuart Rotator SB3 (rotating at 4RPM) placed in a heating cabinet (Binder, GmBH, Tuttlingen, Germany) set at 45 °C. the tubes were then removed from the incubator and photographed. Since the physical structure of the samples appeared partially dissolved, the tubes were vigorously hand shaken for approx. 2 seconds and photographed one more time.
[0159] The tubes were then centrifuged at 1350g for 10 minutes at 4 °C. The supernatant was then decanted, the supernatant and pellet were dried for 2 days at 60 °C in the heating cabinet. The dry matter weight was recorded and used to calculate the dry matter distribution. Dry matter conversion in the samples was calculated based on these numbers. As a control, a microbial inoculum sample (solids content 4.54 % ±0.06) was incubated without substrate to assess base solids release (33.9% ±0.8). The conversion of substrate solids added by microbial inoculum was corrected by subtracting the contribution of solids to the liquid fraction of the microbial inoculum itself.
[0160] The relatively high base in these samples possibly overestimates the base observed in the samples containing the added substrate. This high base could include considerable contribution of cell mass that, in the absence of additional food source, returned to a soluble form during the evolution of the experiment, as opposed to the form of a living organism, which readily precipitates under these experimental conditions. For all substrates, the addition of the microbial inoculum resulted in a greater release of solids than this release of solid base, indicating partial hydrolysis of the substrates by the microbial inoculum.
[0161] Figure 4 shows the comparative degradation of cellulosic substrates and model MSW by the microbial inoculum and as aided by CTEC3. As shown, with a clean cellulosic substrate such as tissue paper, CTEC3 clearly provides more extensive degradation at the given dose level. Using comparative tissue paper degradation as an estimate of cellulase activity, the microbial inoculum is shown to exhibit approximately 1/6 of the activity exhibited by CTEC3. The microbial derived cellulase activity expressed by the microbial inoculum can thus be estimated as (1/6)*(286 FPU/L) or approximately 48 FPU/L within the 24-hour incubation time period.
[0162] It should be noted that the precise mechanisms by which microbial derived cellulase activity is provided are not known. Without wishing to be bound by theory, it appears to us that substrate contact induces the expression of cellulase activity in a way that is effectively “local” to the donor organism and arises effectively during the incubation cycle. To the extent that this is correct, the microbially derived cellulase activity will primarily “follow” the living cells.
[0163] The CTEC3 samples are also presented for providing a more extensive degradation of the MSW model. Here, however, white substrate degradation is high, suggesting that some microbial activity may also have contributed to CTEC3 degradation.
[0164] Ironically, despite much lower levels of cellulase activity per se in FPU/L, the microbial inoculum is shown to achieve levels of cellulosic fraction degradation from the model MSW that are comparable to levels achieved using CTEC3.
[0165] Figure 5 shows a photograph taken after shaking three tubes to which the cellulosic fraction of model MSW was added as substrate, showing the comparative appearance at the end of the incubation. As shown, the cellulosic fraction is, in fact, degraded approximately equivalently compared to CTEC3 and inoculum samples. It has been previously reported in lactic acid fermentations with simultaneous hydrolysis using isolated cellulase preparations, see Schmidt and Padukone 1997, that typical cellulase activities at levels as high as 25 FPU/g DM glossy journal paper and other coated paper, just like newspaper, with less than half the efficiency they can with clean synopsis paper. The results presented here suggest that some enzyme activities, in addition to cellulase activity, can be expressed by the microbial inoculum or its progeny that contribute to degradation of the cellulosic fraction of the model MSW. EXAMPLE 3. CHARACTERIZATION OF LAB BACTERIAL COUNTS
[0166] During the test described in Example 1, the samples from the buffer/fermentor tank (microbial inoculum) as well as the samples of the biogenic slurry obtained after the 3 mm sieve called "EC12B" were removed at various points in time during the time period 235 to 319.
[0167] Aliquots of the samples were removed and dry matter content determined by drying at room temperature (in order to avoid damage to the DNA content). Thawed samples obtained in 50 ml tubes are then frozen with 50% by weight of glycerol added.
[0168] Cell counts were determined by quantitative PCR (qPCR). 5 ml of the cells suspended in glycerol were suspended in 5 ml of sterile filtered H2O. An aliquot was filtered through a filter and the solids concentration determined. DNA was extracted from the filtered cell mass using a FastDNA™ kit (MP BIOMEDICALS™). The number of 16S rRNA gene copy numbers in the extracted DNA was quantified by qPCR analysis with universal 16S rRNA gene primers. The method quantifies only Bacteria and not Archaeal. The bacterial cell number was calculated based on these data, assuming an average of 3.0 16s rRNA gene copy numbers per living cell. The calculated bacterial cell numbers were then related to the concentration of dry matter (total solids) in the samples. The calculated CFU/g DM was used to estimate CFU/L when the microbial inoculum was, on average, 3.95% by weight of DM over the time period and when the biogenic slurry was, on average, 11.98 % by weight of DM.
[0169] The bacterial counts per g of dry matter for the samples are presented in Table 4, along with an estimate of UFC/L. TABLE 4. COUNTS OF LIVE BACTERIA AND MICROBIAL MINOCULE AND BIOGENIC FLUID PASTE

[0170] These results clearly demonstrate that live bacterial cells follow the biogenic slurry. Likewise, it can be expected that the biogenic slurry itself can provide an effective inoculum and will provide microbially derived cellulase activity for post-fermentation of biodegradable fibers collected by various sieves, as well as for undissolved solids retained in the slurry at the time from the initial separation of non-degradable solids.
[0171] These results indicate that microbial hydrolysis and fermentation induced by microbial inoculum resulted in relatively fixed growth during the hydrolysis and fermentation cycle and that the biogenic slurry obtained can be expected by providing a suitable inoculum for post-fermentation with recovered fibers in the different sieves.
[0172] Generally, LAB is expected to comprise a greater proportion of the microbial population that evolves when MSW is simply incubated at temperatures between 37 and 50 °C. See, for example, Akao et al. 2007a; Akao et al. 2007b; Sakai et al. 2000; Sakai et al. 2004. Counts of live LAB bacteria in the order of 1010 CFU/L can be routinely obtained within about 12 hours in lactic acid fermentation from domestic model residue, without added enzyme activity. See Sakai et al. 2000 and Sakai et al. 2004. The generation of lactic acid bacteria folding times identified in the examples presented subsequent to example 3 are on the order of 4 to 5 hours. See Liong and Shaw 2005.
[0173] The proportion of live bacteria in the samples representing lactic acid bacteria can be decisively determined from the 16s RNA measurements described in Example 4. However, these results will not be available until post-deposit. In all of the previous experimental studies at the REnescience demonstration plant involving inoculation of incoming MSW with recirculated wash waters, when samples were properly frozen with glycerol to protect the organisms, Lactobacillus species appeared to predominate, invariably comprising more than 90% organisms totals detected in samples from the enzyme reactor/microbial fermentation reactor and from the biogenic slurry. Likewise, when we estimated that Lactobacillus species (which are likely not only present in LAB) comprise at least 90% of living cells, levels of LAB in the aqueous phase within the enzyme reactor/microbial fermentation reactor in Example 1 were maintained during the hydrolysis and fermentation cycle to at least 2.1 x 1010 UFC/L. EXAMPLE 4. IDENTIFICATION OF MICROORGANISMS PROVIDING HYDROLYSIS AND FERMENTATION IN EXAMPLE 1
[0174] Biogenic slurry samples obtained after passing through an 8 mm sieve called "EC12B", and liquid (microbial inoculum) from the buffer/fermenter tank called "EA02", as well as samples from the water heater " LB01" were obtained during the test at hours 101 and 125, during the first period with CTEC3 added, at hour 245, at the end of the "rise time without CTEC3" at hour 269, during the period with microbial fermentation only, and at hours 341 and 365, during the second period with added CTEC3.
[0175] Liquid samples were frozen in 20% glycerol and stored at -20 °C for the purpose of performing 16S rDNA analysis to identify microorganisms. This analysis is well known in the art and is widely identified for the identification and phylogenetic analysis of prokaryotes based on the 16S component of the small ribosomal subunit. Frozen samples were shipped on dry ice to GATC Biotech AB, Solna, SE where 16S rDNA analysis was performed (GATC_Biotech).
[0176] The analysis comprised: genomic DNA extraction, amplicon library preparation using the primer pair of universal primers covering the hypervariable regions V1 to V3 27F: AGAGTTTGATCCTGGCTCAG / 534R: ATTACCGCGGCTGCTGG; 507 bp long), PCR tagging with FLX GS adapters, sequencing on a FLX Genome Sequencer instrument to get a quantity of 104,000-160,000 reads per sample. The resulting sequences were then queried in a BlastN against the Ribosomal Database Project's rDNA database (Cole et al., 2009). The database contains good quality sequences at least 12.00 bp in length and a taxonomic association of NCBI. The current release (RDP Release 10, Updated September 19, 2012) contains 9,162 bacteria and 375 archaeal sequences. BLAST results were filtered to remove short and low quality matches (sequence identity > 90%, alignment coverage > 90%).
[0177] The project number for the samples registered in GATC was NG-7116. Results will be available post-deposit. EXAMPLE 5. CONCOMITANT MICROBIAL FERMENTATION IMPROVES ORGANIC CAPTURE BY ENZYMATIC HYDROLYSIS OF UNSEPARATED MSW USING ISOLATED ENZYME PREPARATIONS
[0178] Laboratory bench scale reactions were conducted with the biodegradable slurry sample from the test described in example 9.
[0179] The MSW-model substrate for laboratory scale reactions was prepared using fresh product to understand the organic fraction (defined as the cellulosic, animal and vegetable fractions) of municipal solid waste (prepared as described in Jensen et al., 2010 based on Riber et al. 2009)...
[0180] Model MSW were stored in aliquots at -20 °C and thawed overnight at 4 °C. Reactions were carried out in 50 ml centrifuge tubes, and the total reaction volume was 20 g. Model MSW were added to 5% dry matter (DM) (measured as dry matter content remaining after 2 days at 60 °C).
[0181] The cellulase applied for hydrolysis was Cellic CTec3 (VDNI0003, Novozymes A/S, Bagsvaerd, Denmark) (CTec3). To adjust and maintain the pH at pH5, a citrate buffer (0.05 M) was applied to make up the total volume to 20 g.
[0182] Reactions were incubated for 24 hours on a Stuart Rotator SB3 (rotating at 4 RPM) placed in a heating oven (Binder GmBH, Tuttlingen, Germany). Negative controls were run in parallel to assess the background release of substrate dry matter during incubation. After incubation, the tubes were centrifuged at 1350 g for 10 minutes at 4 °C. The supernatant was then decanted off, 1 ml was removed for HPLC analysis and the pellet and remaining supernatant were dried for 2 days at 60°C. The dry matter weight was recorded and used to calculate the dry matter distribution. The DM conversion in MSW-model was calculated based on these numbers.
[0183] The concentrations of organic acids and ethanol were measured using an UltiMate 3000 HPLC (Thermo Scientific Dionex) equipped with a refractive index detector (Shodex® RI-101) and a UV detector at 250 nm. Separation was performed on a Rezex RHM monosaccharide column (Phenomenex) at 80 °C with 5 mM H2SO4 as eluent at a flow rate of 0.6 ml/min. The results were analyzed using the Chromeleon software program (Dionex).
[0184] To assess the effect of concomitant hydrolysis and fermentation, 2 ml/20 g of the bioliquid from the test described in example 5 (sampled on December 15 and 16) was added to the reactions with or without CTec3 (24 mg/g of DM). DM TO MSW CONVERSION
[0185] Solids conversion was measured as the solids content found in the supernatant as a percentage of the total dry matter. Figure 1 shows the conversion to raw material of MSW raw material, isolated enzyme preparation, microbial inoculum alone and the combination of microbial inoculum and enzyme. The results show that the addition of EC12B from example 5 resulted in significantly higher dry matter conversion compared to background dry matter release in the reaction raw material (MSW raw material) (Student's t-test p<0, 0001). Concomitant microbial fermentation induced by sample addition of EC12B and enzymatic hydrolysis using CTec3 resulted in significantly higher dry matter conversion compared to the reaction hydrolyzed with CTec3 alone and the reactions with addition of EC12B alone (p< 0.003). HPLC ANALYSIS OF GLUCOSE, LACTATE, ACETATE AND ETOH
[0186] The concentration of glucose and microbial metabolites (lactate, acetate and ethanol) measured in the supernatant are shown in Figure 2. As shown, there was a low background concentration of the same in the MSW-model raw material, and the content of Lactic acid presumably comes from bacteria native to the MSW-model since the material used to create the substrate was in no way sterilized or heated to kill bacteria. The effect of adding CTec3 resulted in an increase in glucose and lactic acid in the supernatant. The highest concentrations of glucose and bacterial metabolites were found in reactions where the EC12B bioliquid from example 5 was added concomitantly with CTec3. Concomitant hydrolysis and fermentation, therefore, improve the dry matter conversion in the model MSW and increase the concentration of bacterial metabolites in the liquids.
[0187] References: Jacob Wagner Jensen, Claus Felby, Henning J0rgensen, Georg Ornskov R0nsch, Nanna Dreyer N0rholm. Enzymatic processing of municipal solid waste. Waste Management. 12/2010; 30(12): 2,497 to 2,503.
[0188] Riber, C., Petersen, C., Christensen, T.H., 2009. Chemical composition of material fractions in Danish household waste. Waste Management 29, 1,251 to 1,257. EXAMPLE 6. CONCOMITANT MICROBIAL FERMENTATION IMPROVES ORGANIC CAPTURE BY ENZYMATIC HYDROLYSIS OF UNSEPARATED MSW USING ISOLATED ENZYME PREPARATIONS
[0189] Tests were performed in a specially designed batch reactor shown in Figure 8, with the use of unsorted MSW in order to validate the results obtained in laboratory scale experiments. The experiments tested the effect of adding an inoculum of microorganisms comprising the bioliquid obtained from bacteria of example 7 in order to achieve concomitant microbial fermentation and enzymatic hydrolysis. Tests were performed using non-separated MSW.
[0190] MSW used for small scale trials have been a focal point of research and development in REnescience. In order for the test results to be of value, it was necessary that the residue be representative and reproducible.
[0191] The waste was collected from Nomi I/S Holstebro in March 2012. The waste was unsorted municipal solid waste (MSW) from the respective area. The residue was ground to 30 x 30 mm for use in small-scale trials and to collect representative samples for trials. Sampling theory was applied to crushed waste by sub-sampling crushed waste in 22 liter tubs. The tubs were stored in a freezer container at -18°C until use. The “actual waste” consisted of eight collection waste tubs. The content of these tubs was again mixed and again sampled in order to ensure that the variability between replicates was as low as possible.
[0192] All samples were run under similar conditions regarding water, temperature, rotation and mechanical effect. Six chambers were used: three without inoculation and three with inoculation. The non-aqueous content during the test was set to 15% of the non-aqueous content by adding water. The dry matter in the inoculation material was considered, so the addition of water in the inoculated chambers was lower. 6 kg of MSW was added to each chamber, as was 84 g of CTEC3, a commercial cellulase preparation. 2 liters of inoculum was added to the inoculated chambers, with a corresponding reduction in added water.
[0193] The pH was maintained at 5.0 in the inoculated chambers and at pH 4.2 in the uninoculated chambers with the use respectively of addition of 20% of NaOH to increase the pH and 72% of H2SO4 to decrease the pH. The lower pH in the uninoculated chamber helped to ensure that intrinsic bacteria did not grow. It was previously shown that, with the use of the enzyme preparation used, CTEC3 Tm, in the context of MSW hydrolysis, no difference in activity could be discerned between pH 4.2 and pH 5.0. The reaction was continued at 50 °C for 3 days, with the pilot reactor providing constant rotational agitation.
[0194] At the end of the reaction, the chambers were emptied through a sieve and bioliquid comprising liquefied material produced by microbial fermentation and concomitant enzymatic hydrolysis of MSW.
[0195] The dry matter (TS) and volatile solids (VS) were determined by the Dry Matter (DM) method:
[0196] Samples were dried at 60 °C for 48 hours. The sample weight before and after drying was used to calculate the DM percentage.

[0197] Volatile Solids Method:
[0198] Volatile solids are calculated and presented as the percentage of DM minus the ash content. The ash content of a sample was found by firing the pre-dried sample at 550 °C in a furnace for a minimum of 4 hours. Then the ash was calculated as:
[0199] Percentage of Dry Matter Sample Ash:

[0200] Percent Volatile Solids: (1 - Percent Sample Ash) x Percent Sample DM
[0201] The results were as shown below. As shown, a higher total solids content was obtained in the bioliquid obtained in the inoculated chambers, indicating that the concomitant microbial fermentation and enzymatic hydrolysis were superior to enzymatic hydrolysis alone.

EXAMPLE 7. CONCOMITANT MICROBIAL FERMENTATION IMPROVES ORGANIC CAPTURE BY ENZYMATIC HYDROLYSIS OF UNSEPARATED MSW WITH THE USE OF ISOLATED ENZYME PREPARATIONS
[0202] Experiments were conducted at the REnescience demonstration plant located in Amager ressource center (ARC), Copenhagen, Denmark. A schematic drawing showing the main features of the plant is shown in Figure 1. The concept of the ARC REnescience Waste Refinery is as described generally in example 1.
[0203] REnescience technology, as tested in this example, comprises three steps.
[0204] The first step is a gentle heating (pre-treatment, as shown in Figure 4) of the MSW by hot water at temperatures in the range of 40 to 75 oC for a period of 20 to 60 minutes. This mixing and heating period opens plastic bags and provides adequate pulping of degradable components by preparing a more homogeneous organic phase prior to addition of enzymes. The temperature and pH are adjusted in the heating period to ideal for isolated enzyme preparations that are used for enzymatic hydrolysis. Hot water can be added as clean tap water or as wash water first used in wash drums and then recirculated for gentle heating as indicated in Figure 1.
[0205] The second step is enzymatic fermentation and hydrolysis (liquefaction as shown in Figure 4). In the second step of the REnescience process, enzymes are added and the microorganisms optionally selected. The enzymatic fermentation and liquefaction is carried out continuously in a residence time of approximately 16 hours, at the ideal temperature and pH for enzyme performance. Through this fermentation and hydrolysis, the biogenic part of MSW is liquefied into a bioliquid with a high content of dry matter among non-degradable materials. The pH is controlled by the addition of CaCO3.
[0206] The third step of REnescience technology as practiced in this example is a separation step in which the bioliquid is separated from the non-degradable fractions. Separation is carried out in a ballistic separator, wash drums and hydraulic presses. The ballistic separator separates the enzymatic treated MSW in the bioliquid, a fraction of 2D non-degradable materials and a fraction of 3D non-degradable materials. The 3D fraction (three-dimensional physical objects such as cans and plastic bottles) does not agglutinate large amounts of bioliquid, so a single washing step is sufficient to clean the 3D fraction. The 2D fraction (textiles and metal sheets as examples) binds a significant amount of bioliquid. Therefore the 2D fraction is pressed using a screw press, washed and pressed again to optimize bioliquid recovery and to obtain a dry and “clean” 2D fraction. The inert material that is sand and glass is sieved from the bioliquid. The water used in all wash drums can be recirculated, heated and then used as hot water in the first step for heating.
[0207] The test documented in this example was divided into three sections as shown in table 5 TABLE 5 Time (hours) Rodalon Tap water / Wash water on gentle heating

[0208] In a 7-day trial, unsorted MSWs obtained from Copenhagen, Denmark were continuously loaded at 335 kg/h into the REnescience demonstration plant. In the gentle heating, 536 kg/h of water (tap water or wash water) heated to approximately 75°C was added before entering the gentle heating reactor. The temperature is thereby adjusted to approximately 50 °C in the MSW and the pH is adjusted to approximately 4.5 by addition of CaCO3.
[0209] In the first section, the surface-active antimicrobial agent Rodalon™ (alkyl benzyl ammonium chloride) was included in the water added in 3 g of active ingredient per kg of MSW.
[0210] In the liquefaction reactor approximately 14 kg of Cellic Ctec3 (commercially available cellulase preparation from Novozymes) are added per wet ton of MSW. The temperature was maintained in the range of 45 to 50 °C and the pH was adjusted in the range of 4.2 to 4.5 by adding CaCO3. The retention time of the enzyme reactor is approximately 16 hours.
[0211] In the ballistic separator separation system, presses and washing drums, the bioliquid (liquefied degradable material) is separated from non-degradable materials.
[0212] The wash waters were selectively either poured out, recording the organic content, or recirculated and reused to wet the incoming MSW in the gentle heating. The recirculation of washing water has the effect of carrying out bacterial inoculation using organisms that live in reaction conditions at 50 °C at levels higher than those present initially. In the process scheme used, the recirculated wash water was first heated to approximately 70 °C to bring the incoming MSWs to a suitable temperature for enzymatic hydrolysis, and in such a case, around 50 °C. Specifically in the case of lactic acid bacteria, heating to 70 °C has been found to provide a selection and “induction” of expression of thermal tolerance.
[0213] Samples were obtained at selected time points in the following places: - The bioliquid that leaves the small sieve, which is called "EC12B" - The bioliquid in the storage tank - The wash water after the wheat sieve - The 2D fraction - The 3D fraction - The inert bottom fraction of both washing units
[0214] Biodegradable slurry production was measured with load cells in the storage tank. Fresh water inflow was measured with flowmeters, recycled or drained wash residue was measured with load cells.
[0215] Bacterial counts were examined as follows: Selected bioliquid samples were diluted 10 times in the SPO (peptone water solution) and 1 ml of the dilutions was plated at sowing depth on Beef Extract Agar (3, 0 g/L Beef Extract (Fluka, Cas.: B4888), 10.0 g/L Tryptone (Sigma, cas number: T9410), 5.0 g/L NaCl (Merck, cas number 7647-14- 5), 15.0 g/L agar (Sigma, cas number 9002-18-0)). Plates were incubated at 50 degrees respectively. Aerobic and anaerobic atmosphere. Anaerobic cultivation took place in suitable containers that were kept anaerobic through gasification with Anoxymat and addition of iltfjernende letters (AnaeroGen from Oxoid, cat number AN0025A). Aerobic colonies were counted after 16 hours and again after 24 hours. Bacteria in anaerobic growth were quantified after 64 to 72 hours.
[0216] Figure 9 shows the total volatile solids content in bioliquid samples in EC12B as kg per kg of MSW processed. Point estimates were obtained at different time points during the experiment by considering each of the three separate experimental periods as a separate time period. In this way, a point estimate during period 1 (Rodalon) is expressed in relation to mass balances and material flows during period 1. One shown in Figure 5, during period 1, which was initiated after a prolonged interruption due to to complications in the plant, it is noticed that the total solids captured in the bioliquid drip stably, consistent with a mild antibacterial effect of Rodalon™. During period 2, total captured solids return to slightly higher levels. During period 3, when the recirculation provides an effective “inoculation” of incoming MSW, the ratio of kg VS/kg bioliquid affald is raised to considerably higher levels by about 12%.
[0217] For each of the 10 time points shown in Figure 9, bioliquid samples (EC12B) were taken and the total solids, volatile solids, dissolved volatile solids and concentrations of the presumed bacterial metabolites acetate, butyrate, ethanol, formate and propionate were determined by HPLC. Such results which include glycerol concentrations are shown in Table 1 below. TABLE 6. ANALYSIS OF BIODEGRADABLE FLUID PASTES SAMPLES

[0218] For the biodegradable slurry samples taken at each of the ten time points, Figure 10 both the live bacterial counts determined under aerobic conditions and also the weight percentage "bacterial metabolites" (which means the sum of acetate, butyrate, ethanol, formate and propionate) expressed as a percentage of dissolved volatile solids. As shown, the weight percentage of bacterial metabolites clearly increases with increased bacterial activity and is associated with increased solids capture in the bioliquid. EXAMPLE 8. IDENTIFICATION OF MICRO-ORGANISMS THAT CONTRIBUTE TO THE CONCOMITANT FERMENTATION IN EXAMPLE 7
[0219] The bioliquid samples obtained from example 7 were analyzed for microbial composition.
[0220] The microbial species present in the sample were identified by comparing their 16S rRNA gene sequences with the rRNA gene sequences of well-characterized species (reference species). The normal cut-off value for species identification is 97% similarity of the 16S rRNA gene sequence to a reference species. If the similarity was below 97%, it would probably be a different species.
[0221] The resulting sequences were queried in a BlastN against the NCBI database. The database contains good quality sequences at least 1200 bp in length and a taxonomic association of NCBI. Only results from BLAST matches > 95% identity were included.
[0222] The sampled biodegradable slurry was directly transferred for analysis without being frozen prior to DNA extraction.
[0223] A total of 7 bacterial species were identified (Figure 11) and 7 species of Archea were identified. In some cases, the bacterial species, the subspecies, could not be assigned (L. acidophilus, L. amylovorus, L. sobrius, L. reuteri, L. frumenti, L. fermentum, L. fabifermentans, L. plantarum, L. pentosus). EXAMPLE 9 . DETAILED ANALYSIS OF ORGANIC CAPTURE USING MICROBIAL FERMENTATION AND ENZYMATIC HYDROLYSIS OF UNSEPARATED MSW USING ISOLATED ENZYME PREPARATIONS
[0224] The REnescience demonstration plant described in example 1 and example 7 was used to produce a detailed study of total organic capture using concomitant bacterial fermentation and enzymatic hydrolysis of unsorted MSW.
[0225] The Copenhagen garbage was characterized by Econet for determining its content.
[0226] The residue analysis was analyzed by determining the content and the variation. A large sample of MSW was delivered to Econet A/S, which performed the residue analyses. The primary sample was reduced to a sub-sample of about 50 to 200 kg. This sub-sample was then separated by trained personnel into 15 different waste fractions. The weight of each fraction was recorded and a distribution was calculated. TABLE 7 RESIDUE COMPOSITION AS (%) OF TOTAL, ANALYZED BY ECONET DURING THE 300 HOUR TEST


[0227] The residue composition varies from time to time, table 7 shows the result of residue analysis of different samples collected over 300 hours. The greatest variation is seen in the diaper, plastic and cardboard packaging, and food waste fractions, all of which are fractions that affect the content of organic material that can be captured.
[0228] Over the entire course of the “300-Hour Test,” the average “captured” biodegradable material expressed as kg of VS per kg of MSW processed was 0.156 kg of VS/kg of MSW input.
[0229] Representative bioliquid samples were taken at various time points during the course of the experiment when the plant was in a period of stable operation. Samples were analyzed by HPLC and determined volatile solids, total solids and dissolved solids as described in example 7. The results are shown in Table 8 below. TABLE 8. BIOLIQUID SAMPLES ANALYSIS
EXAMPLE 10. IDENTIFICATION OF MICRO-ORGANISMS THAT CONTRIBUTE TO COMPETITIVE FERMENTATION IN EXAMPLE 9
[0230] Note: In this example, material samples analyzed for the identification of microorganisms were frozen without glycerol. The results obtained are inconsistent with the observed high lactate levels and with all other results obtained in all other tests when samples are frozen with added glycerol and are not believed to be accurate.
[0231] A sample of the biodegradable slurry "EC12B" was taken during the test described in example 9 on December 15 and 16, 2012 and stored at -20 °C for the purpose of performing 16S rDNA analysis to identify microorganisms in the sample. 16S rDNA analysis is widely used for the identification and phylogenetic analysis of prokaryotes based on the 16S component of the small ribosomal subunit. Frozen samples were shipped on dry ice to GATC Biotech AB, Solna, SE where 16S rDNA analysis was performed (GATC_Biotech). genomic DNA extraction, amplification library preparation using universal primer primer pair spanning hypervariable regions V1 to V3 27F: AGAGTTTGATCCTGGCTCAG / 534R: ATTACCGCGGCTGCTGG; 507 bp in length), PCR tagging with FLX GS adapters, sequencing on a FLX Genome Sequencer instrument (FLX Genome Sequencer) to obtain an amount of 104,000 to 160,000 reads per sample. The resulting sequences were then queried in a BlastN against the Ribosomal Database Project rDNA database (Ribosomal Database Project) (Cole et al., 2009). The database contains good quality sequences at least 12.00 bp in length and a taxonomic association of NCBI. The current release (RDP Release 10, Updated September 19, 2012) contains 9,162 bacteria and 375 archaeal sequences. BLAST results were filtered to remove short and low quality matches (sequence identity > 90%, alignment coverage > 90%).
[0232] A total of 226 different bacteria were identified.
[0233] The predominant bacteria in the EC12B sample were Paludibacter propionicigenes WB4, a propionate-producing bacterium (Ueki et al. 2006), which comprises 13% of the total bacteria identified. Distribution of the 13 predominant bacteria identified (Paludibacter propionicigenes WB4, Proteiniphilum acetatigenes, Actinomyces europaeus, Levilinea saccharolytica, Cryptanaerobacter phenolicus, Sedimentibacter hydroxybenzoicus, Clostridium phytofermentans ISDg, Clostridium phytofermentans ISDg, Clostridium phytofermentans ISDg, Clostridium phytofermentans ISDg, Clostridium phytofermentans D. ) is shown in Figure 11.
[0234] The comparison of bacteria identified at the genus level showed that Clostridium, Paludibacter, Proteiniphilum, Actinomyces and Levilinea (all anaerobic) accounted for approximately half of the identified genera. The Lactobacillus genus comprises 2% of the identified bacteria. The predominant bacterial species, P. propionicigenes WB4, belongs to the second most predominant genus (Paludibacter) in the EC12B sample.
[0235] The predominant pathogenic bacteria in the EC12B sample were the Streptococcus spp., which comprise 0.028% of the total bacteria identified. No spore-forming pathogenic bacteria were found in the bioliquid.
[0236] Streptococcus spp. was the only pathogenic bacteria present in the bioliquid in example 9. Streptococcus spp. are the bacteria with the highest temperature tolerance (those that do not form spore) and the highest D-value, which indicates that the amount of time required, at a given temperature, to reduce the amount of living Streptococcus spp. times ten is superior to any of the other pathogenic bacteria reported by Déportes et al. (1998) in MSW. Such results show that the conditions applied in example 9 can sanitize MSWs during separation in the REnescience process to a level where only Streptococcus spp. are present.
[0237] The competition between organisms for nutrients and the increase in temperature during the process will significantly decrease the amount of pathogenic organisms and, as shown above, eliminate the presence of pathogens in separate MSW in the REnescience process. Other factors such as pH, aw, oxygen tolerance, CO2, NaCl and NaNO2 also influence the growth of pathogenic bacteria in the bioliquid. The interaction between the factors mentioned above can decrease the time and temperature needed to reduce the amount of living cells during the process. EXAMPLE 11. DETAILED ANALYSIS OF ORGANIC CAPTURE USING COMPETITIVE MICROBIAL FERMENTATION AND ENZYMATIC HYDROLYSIS USING UNSEPARATED MSW ISOLATED ENZYME PREPARATIONS OBTAINED FROM A DISTANT GEOGRAPHICAL LOCATION
[0238] The REnescience demonstration plant described in example 7 was used to process the MSW imported from the Netherlands. It was found that MSW have the following composition: TABLE Y RESIDUE COMPOSITION (5) TOTAL, ANALYZED BY ECONET DURING THE VAN GANSEWINKEL TEST.

[0239] The material was subjected to microbial fermentation and concurrent enzymatic hydrolysis as described in example example 7 and 9 and tested for a 3-day plant cycle. Biodegradable slurry samples obtained at various time points were obtained and characterized. The results are shown in Table 9. The percentages given are the percentage of total weight. TABLE 9. BIOLIQUID ANALYSIS

[0240] The dissolved VS was corrected with 9% according to the loss of lactate during drying. EXAMPLE12. PRODUCTION OF BIOMETHANE WITH THE USE OF BIOLIQUID OBTAINED FROM COMPETITIVE MICROBIAL FERMENTATION AND HYDROLYSIS AND ENZYMATIC OF MSW NOT SEPARATED AS USE OF ISOLATED ENZYME PREPARATIONS
[0241] The biodegradable slurry obtained in the experiment described in example 9 was frozen in 20 liter tubs and stored at -18 °C for later use. Such material was tested for biomethane production using two identical well-prepared fixed filter anaerobic digestion systems comprising an anaerobic digestion consortium within a biofilm immobilized on the filter holder.
[0242] The initial samples were collected for both the feed and the liquid inside the reactor. VFA, tCOD, sCOD and ammonia concentrations are determined using HACH LANGE cuvette tests with a DR 2 800 Spectrophotometer and detailed VFAs were determined daily by HPLC. TSVS measurements are also determined using the Gravimetric Method.
[0243] Gas samples for GC analysis are taken daily. The verification of the feed rate is carried out by measuring the slack volume in the feed tank and, in addition, the amount of effluent leaving the reactor. Sampling during the process was carried out through the collection with a syringe of liquid or effluent”.
[0244] Stable biogas production was observed with the use of both digester systems over a period of 10 weeks, which corresponds to between 0.27 and 0.32 L/g of CO2.
[0245] Slurry feed was then discontinued in one of the two systems and the return to baseline was monitored as shown in Figure 13. The stable gas production level is shown by the horizontal line indicated as 2. The The time point at which feeding was discontinued is shown in the vertical lines indicated as 3. As shown, after months of stable operation, there remained a residual resilient material that was converted during the period indicated between the vertical lines indicated as 3 and 4. return to baseline or “down ramp” is shown in the period after the vertical line indicated as 4. After a baseline period, feed was again started at the point indicated by the vertical line indicated as 1. Elevation of steady-state gas production or "ramp up" is shown in the period after the vertical line indicated as 1.
[0246] The gas production parameters from the bioliquid including the “ramp up” and “ramp down” measured as described are shown below.

*Ramp up time is the time from the first feed until gas production stops increasing and stabilizes. Up ramp time indicates the level of easily converted organics in the feed. **Ramp Down Time is the time from the last feed until gas production stops steeply decreasing. The down ramp time shows gas production from easily converted organics. ***Burn is the time after Ramp Down Time until gas production completely stops at base level. Burning time shows gas production from slowly converted organics. ****Fixed for 2 l/day background gas production. EXAMPLE13.BIOMETHANE PRODUCTION COMPARATIVE WITH THE USE OF BIODEGRADABLE FLUIDS OBTAINED FROM MSW HYDROLYSIS AND ENZYMATIC ARE NOT SEPARATED WITH THE USE OF ENZYME PREPARATIONS ISOLATED WITH AND IN FERMENTATION COMPETITOR MICROBIAL
[0247] The "high lactate" and "low lactate" bioliquids obtained in example 6 were compared for biomethane production as using the fixed filter anaerobic digestion system described in example 8. Measurements were obtained and the times of " ramp up" and "ramp down" were determined as described in example 11.
[0248] Figure 14 shows the characterization of “ramp up” and “ramp down” of the “high lactate” bioliquid. The level of steady-state gas production is shown by the horizontal line indicated as 2. The time point at which the feed was started is shown by the vertical lines indicated as 1. The rise in steady-state gas production or “ramp up ” is shown in the period after the vertical line indicated as 1. The time point at which the feed was discontinued is shown in the vertical line indicated as 3. The return to baseline or “ramp down” is shown in the period that follows the vertical line indicated by 3 to the period on the vertical line indicated by 4.
[0249] Figure 15 shows the same characterization of the “low lactate” bioliquid, with the relevant points indicated as described for Figure 14..
[0250] Comparative gas production parameters from “high lactate” and “low lactate” bioliquids, which include the measured “slope up” and “slope down” as described, are shown below.
[0251] The difference in “ramp up”/”ramp down” times show the differences in the ease of biodegradability. The most easily converted biomasses will ultimately have the highest total conversion rate in a gas bioproduction application. Furthermore, “faster” biomethane substrates are more ideally suited for conversion through faster anaerobic digestion systems such as fixed filter digesters.
[0252] As shown, “high lactate” bioliquid exhibits a “ramp up” and “ramp down” time in biomethane production.


*Ramp up time is the time from the first feed until gas production stops increasing and stabilizes. Up ramp time indicates the level of easily converted organics in the feed. **Ramp Down Time is the time from the last feed until gas production stops steeply declining. The down ramp time shows gas production from easily converted organics. ***Burn is the time after Ramp Down Time until gas production completely stops at base level. Burning time shows gas production from slowly converted organics. ****Fixed for 2 l/day background gas production EXAMPLE 14. PRODUCTION OF BIOMETHANE WITH THE USE OF BIODEGRADABLE FLUID PASTE OBTAINED FROM FERMENTATION COMPETITIVE MICROBIAL AND ENZYMATIC HYDROLYSIS OF HYDROTHERMICAL PRE-TREATED LIQUID STRAW WITH THE USE OF ISOLATED ENZYME PREPARATIONS
[0253] Wheat straw was pretreated, separated into a fiber fraction and a liquid fraction, and then the fiber fraction was washed separately. 5 kg of washed fiber were incubated in a horizontal rotary drum reactor with a dose of Cellic CTEC3 with an inoculum of fermentation microorganisms consisting of biodegradable slurry obtained from example 7. Wheat straw was subjected to simultaneous microbial hydrolysis and fermentation for 3 days at 50 degrees.
[0254] Such bioliquid was then tested for biomethane production using the fixed filter anaerobic digestion system described in example 8. Measurements were obtained for the "ramp up" time as described in example 11 .
[0255] Figure 16 shows the “ramp up” characterization of hydrolyzed wheat straw bioliquid. The level of steady-state gas production is shown by the horizontal line indicated as 2. The time point at which the feed was started is shown by the vertical lines indicated as 1. The rise in steady-state gas production or “ramp up ” is displayed in the period after the vertical line indicated as 1.
[0256] The gas production parameters of the wheat straw hydrolyzate bioliquid are shown below.
[0257] As shown, pretreated lignocellulosic biomass can also be readily used to practice gas bioproduction methods and to produce the innovative biomethane substrates of the invention.

* Ramp up time is the time from the first feed until gas production stops growing and stabilizes. Up ramp time indicates the level of easily converted organics in the feed. * *Ramp Down Time is the time from the last feed until gas production stops steeply decreasing. The down ramp time shows gas production from easily converted organics. * **Burn is the time after Ramp Down Time until gas production completely stops at base level. Burning time shows gas production from slowly converted organics. * ***Fixed for 2 l/day background gas production. EXAMPLE 15. COMPETITIVE MICROBIAL FERMENTATION AND MSW HYDROLYSIS AND ENZYMATIC WITH USE OF ORGANISMS SELECTED
[0258] The concurrent microbial and enzymatic hydrolysis reactions using specific monoculture bacteria were performed on a laboratory scale using the MSW model (described in example 5) and procedure described in the following procedure in example 5. The conditions of reaction and enzyme dosage are specified in Table 10.
[0259] Bacterial strains of Lactobacillus amylophiles (DSMZ No. 20533) and propionibacterium acidipropionici (DSMZ No. 20272) (DSMZ, Braunsweig, Germany) (stored at 4°C for 16 hours until use) were used as an inoculum to determine their effect on dry matter conversion in the MSW model with or without the addition of CTec3. The main metabolites produced by them are lactic acid and propanoic acid, respectively. The concentration of such metabolites was detected using the HPLC procedure (described in example 5).
[0260] Due to the fact that propionibacterium acidipropionici is an anaerobe, the buffer applied in the reactions in which such a strain was applied was purged with the use of nitrogen gas and the live culture was inoculated to the reaction tubes inside a chamber mobile anaerobics (Atmos Bag, Sigma Chemical CO, St. Louis, MO, USA), also purged with nitrogen gas. The reaction tubes with P. propionici were closed before being transferred to the incubator. Reactions were inoculated with 1 ml of both P. propionici and L. amylophilus.
[0261] The results shown in table 4 clearly show that the expected metabolites were produced; propanoic acid was detected in reactions inoculated with p. acidipropionic while propanoic acid was not detected in the control that contained the MSW model with or without CTec3. The lactic acid concentration in the control reaction with only model MSW added was almost equal to the reactions with only L. amylophilus added. The production of lactic acid in such a control reaction is attributed to bacteria native to the MSW model. Some background bacteria were expected due to the fact that the individual components of the model waste were produced fresh, frozen, but were not further sterilized in any way prior to preparation of the model MSW. When L. amylophilus was added simultaneously with CTec3, the lactic acid concentration was almost doubled (Table 10).
[0262] The positive effect on the release of DM into the supernatant after hydrolysis was shown as superior DM conversion in reactions with both L. amylophilus and P. propionici added together with CTec3 (30 to 33% increase compared to with reactions with only CTec3 added).
[0263] Table 10. Bacterial cultures tested on a laboratory scale alone or concurrently with enzymatic hydrolysis. The temperature, pH and CTec3 dosage of 96 mg/g are shown. Control reactions with MSW in buffer with or without CTec3 were performed in parallel to assess the background of bacterial metabolites in reaction. (The mean and standard deviation of 4 reactions are shown with the exception of the MSW controls which were run singly). No. Not detected, below detection limit.
EXAMPLE 16. IDENTIFICATION OF MICROORGANISMS THAT CONTRIBUTE TO COMPETITIVE FERMENTATION IN EXAMPLE 11
[0264] Samples of bioliquid “EC12B” and recirculated water “EA02” were taken during the test described in example 11 (sampling was carried out on March 21 and 22). The liquid samples were frozen in 10% glycerol and stored at -20°C for the purpose of performing 16S rDNA analysis to identify microorganisms in which it is widely used for component-based identification and phylogenetic analysis of prokaryotes 16S of the small ribosomal subunit. Frozen samples were shipped on dry ice to GATC Biotech AB, Solna, SE, where 16S rDNA analysis was performed (GATC_Biotech). The analysis comprises:
[0265] Genomic DNA extraction, amplification library preparation using universal primer primer pair spanning hypervariable regions V1 to V3 27F: AGAGTTTGATCCTGGCTCAG / 534R: ATTACCGCGGCTGCTGG; 507 bp in length), PCR tagging with GS FLX adapters, sequencing on a FLX Genome Sequencer instrument to get a quantity of 104,000 to 160,000 reads per sample. The resulting sequences were then queried in a BlastN against the Ribosomal Database Project's rDNA database (Cole et al., 2009). The database contains good quality sequences at least 12.00 bp in length and a taxonomic association of NCBI. The current release (RDP Release 10, Updated September 19, 2012) contains 9,162 bacteria and 375 archaeal sequences BLAST results have been filtered to remove short and poor quality matches (sequence identity > 90%, alignment coverage >90%).
[0266] In samples EC12B-21/3, EC12B-22/3 and EA02B 21/3, EA02-22/3 a total of 452, 310, 785, 594 different bacteria were identified.
[0267] The analysis clearly showed, at a species level, that Lactobacillus amylolyticus was by far the most dominant bacterium accounting for 26% to 48% of all microbiota detected. The microbiota in the EC12B samples was similar; the distribution of the 13 predominant bacteria (Lactobacillus amylolyticus DSM 11664, subspecies of Lactobacillus delbrueckii, delbrueckii, Lactobacillus amylovorus, subspecies of Lactobacillus delbrueckii, indicus, Lactobacillus similis JCM 2765, subspecies of Lactobacillus delbrueckii, Labacillus D'lbrueckii hamster, 2007 Labacillus delbrue, 2007 parabuchneri, Lactobacillus plantarum, Lactobacillus brevis, Lactobacillus pontis, Lactobacillus buchneri) was practically the same on the two different sampling dates.
[0268] EA02 samples were similar to EC12B, although L. amylolyticus was less dominant. The distribution of the 13 predominant bacteria (Lactobacillus amylolyticus DSM 11664, the subspecies of Lactobacillus delbrueckii, delbrueckii, Lactobacillus amylovorus, subspecies of Lactobacillus delbrueckii, Lactis DSM 20072, Lactobacillus similis JCM 2765, subspecies weicusillus, Lactocillus gillus). Lactobacillus oligofermentans LMG 22743, Weissella beninensis, Leuconostoc gasicomitatum LMG 18811, Weissella soli, Lactobacillus paraplantarum) was also similar with the exception of the occurrence of Pseudomonas extremeustralis 14-3 in the 13 predominant bacterial species. Such Pseudomonas found in EA02 (21/3) was isolated in advance from a temporary pond in Antarctica and must have the capacity to produce polyhydroxyalkanoate (PHA) from both octanoate and glucose (Lopez et al. 2009; Tribelli et al., 2012).
[0269] Comparison of the results at a genus level showed that lactobacillus comprise 56 to 94% of the bacteria identified in the samples. Again, the distribution across genera is extremely similar between the two sampling dates of EC12B and EA02. Interestingly, in the EA02 samples, the genera Weisella, Leuconostoc and Pseudomonas are present to a large extent (1.7 to 22%) although they are only found as minor constituents of the EC12B sample (> 0.1%). Weisella and Leuconostoc both belong to the order of lactobacillales, the same as lactobacillus.
[0270] The predominant pathogenic bacteria in EC12B and EA02 sampled during the test described in example 11 comprise 0.281 to 0.539% and 0.522 to 0.592%, respectively, of the total bacteria identified. The predominant pathogenic bacteria in EC12B samples were Aeromonas spp., Bacillus cereus, Brucella sp., Citrobacter spp., Clostridium perfrigens, Klebsiells sp., Proteus sp., Providencia sp., Salmonella spp., Serratia sp., Shigellae spp. and Staphylococcus aureus (See Figure 3). No spore-forming pathogenic bacteria were identified in EC12B and EA02 described in example 11. The total amount of pathogenic bacteria identified in both EC12B and EA02 was reduced over time, so as to almost dispense with the amount of total bacteria in EC12B in one day.
[0271] In Déportes et al. (1998), an overview of pathogens known to be present in MSW was performed. The pathogens present in the MSW described in examples 7, 9 and 11 are shown in Table 11 (Déportes et al. (1998) and 16S rDNA analysis). In addition to the pathogens described by Déportes et al. (1998), Proteu sp. and Providencia sp. were both found in EC12B and EA02 sampled during the test described in example 11. While Streptococcus spp., the only pathogenic bacteria present in the bioliquid in example 5, was not present. This indicates that another bacterial community is present in EC12B and EA02 in example 9, which may be due to competition between the organisms for nutrients and a slight decrease in temperature during the process that will favor the growth of another bacterial community. TABLE 12. OVERVIEW OF PATHOGENICS PRESENT IN EXAMPLES 7, 9 AND 11


IDENTIFICATION OF CEPA AND DSMZ DEPOSITS
[0272] The EA02 samples from March 21 and 22 taken from the test described in example 7, were sent for plating at the Novo Nordic Center for Biosustainability (NN Center) (Hoersholm, Denmark) for the purpose of identifying and obtaining monocultures of isolated bacteria. Upon arrival at the NN center, the samples were incubated overnight at 50 °C, then plated on different plates (GM17, tryptic soy broth and beef extract extract (GM17 agar: 48.25 g/ l m17 agar, after 20 min of autoclave with glucose added to the final concentration in 0.5%, Tryptic Soy Agar: 30 g/l Tryptic Soy Broth, 15 g/l Agar, Steak Broth (Statens Serum Institute, Copenhagen, Denmark) of 15 g/l agarose added) and grown aerobically at 50°C.
[0273] After one day, the plates were visually inspected and the selected colonies were reseeded on the corresponding plates and sent to the DSMZ for identification.
[0274] The following strains isolated from EA02 recirculated water were placed in the patent deposit in DMSZ, DSMZ, Braunsweig, Germany: IDENTIFIED SAMPLES Sample ID: 13-349 (Bacillus safensis) from (EA02-21/3), DSM 27312 Sample ID: 13-352 (Brevibacillus brevis) from (EA02-22/3), DSM 27314 Sample ID: 13-353 (Bacillus subtilis sp. subtilis) from (EA02-22/3), DSM 27315 Sample ID : 13-355 (Bacillus licheniformis) from (EA02-21/3), DSM 27316 Sample ID: 13-357 (Actinomyces bovis) from (EA02-22 3), DSM 27317 +-SAMPLES NO Sample ID: IDENTIFIED 13 -351 from (EA02-22/3), DSM 27313 Sample ID: 13-362A from (EA02-22/3), DSM 27318 Sample ID: 13-365 from (EA02-22/3), DSM 27319 Sample ID: 13-367 from (EA02-22/3), DSM 27320 REFERENCES: Cole, JR, Wang, Q., Cardenas, E., Fish, J., Chai, B., Farris, RJ, & Tiedje , JM (2009). The Ribosomal Database Project: improved alignments and new tools for rRNA analysis. Nucleic acids research, 37 (suppl 1), (D141 to D145). GATC_Biotech supporting material. Defining the Microbial Composition of Environmental Samples Using Next Generation Sequencing. Version 1. Tribelli, P.M., Iustman, L.J.R., Catone, M.V., Di Martino, C., Reyale, S., Méndez, B.S., López, N.I. (2012). Genome Sequence of the Polyhydroxybutyrate Producer Pseudomonas extremoustralis, the Highly Stress-Resistant Antarctic Bacterium. J. Bacteriol. 194(9):2381. Nancy I. López, N.I., Pettinari, J.M., Stackebrandt, E., Paula M. Tribelli, P.M., Pötter, M., Steinbüchel, A., Méndez, B.S. (2009). Pseudomonas extremoustralis sp. nov., to Poly(3-hydroxybutyrate) Producer Isolated from an Antarctic Environment. Cur. Microbiol. 59(5):514 to 519. The achievements and examples are representative only and are not intended to limit the scope of the claims. REFERENCE LIST Abe and Takagi (1990), “Simultaneous Saccharification and fermentation of cellulose to lactic acid”, Biotechnology and Bioscience 37:93-96. Angelidaki, I. et al. (2006), “Enhanced biogas recovery by applying post-digestion in large-scale centralized biogas plants”, Water Science & Technology 54(2):237-244. Akao et al. (2007a)"Effects of PH and temperature on products and bacterial communities in l-lactate batch fermentation of garbage under unsterile condition" Water Research 41:2636-2642. Akao et al. (2007b) "Semi-continuous l-lactate fermentation of garbage without sterile condition and analysis of the microbial structure", Water research 41:17741780. Arriaga, S., et al. (2011), “Continuous production of hydrogen from oat straw hydrolysate in a biotrickling filter,” International Journal of Hydrogen Energy 36:3442. Asha et al. (2012), “Purification and Characterization of a thermophilic cellulose from a novel cellulolytic strain Paenibacillus barcinonensi”s, J. Microbiol. Biotechol. 22(11):1501-1509. Ballesteros, M. et al. (2010), “Ethanol production from the organic fraction obtained after thermal pretreatment of Municipal Solid Waste,” Appl. Biochem. Biotechnol. 161:423-431. Bandounas L et al (2011), “Isolation and characterization of novel bacterial strains exhibiting ligninolytic potential”, MNC Biotechnology, 11:94. Bendixen, H. (1994), “Safeguards against pathogens in Danish biogas plants,” Water Science and Technology 30(12):171. Bilanin, M., et al. (1997), “Influence of fermented cereal and lactic acid and lactic acid bacteria concentrate on sewage sludge digestion,” Environmental Technology 18:1061. Blume et al. (2013), “Characterization og clostridium thermocellum isolates grown on cellulose and sugarcane bagasse”, Bioenerg, Res. 6:763-775. Bugg T et al (2011) “The emerging role for bacteria in lignin degradation and bio-product formation”, Current Opinion in Biotechnology, 22:394-400. Carrington, E. et al. (1998), “Review of the scientific evidence relating to the controls on the agricultural use of sewage sludge. Part - 1 The evidence underlying the 1989 Department of the Environment Code of Practice for agricultural use of sludge and the sludge (Use in Agriculture) Regulations, Report DETR 4415/3. Part 2 - Evidence since 1989 relevant to controls on the agricultural use of sewage sludge, Report No. DETR 4454/4. WRc report to the Department of the Environment, Transport and the Regions, Department of Health, Ministry of Agriculture, Fisheries and Food and UK Water Industry Research Limited. ISBN 1 898920 37 0. WRc Publications, Swindon. NOTE full text is missing. Chaganti, S., et al. (2012), “Impact of oleic acid on the fermentation of glucose and xylose mixtures to hydrogen and other byproducts,” Renewable Energy 42:60. Chandra R. et al (2011) “Bacterial decolorizatin of black liquer in axenic and mixed condition and charecterization of metabolites”, Biodegradation 22:603-611. Chandra, R., et al. (2012), “Methane production from lignocellulosic agricultural crop wastes: A review in context of the second generation of biofuel production,” Renewable and Sustainable Energy Reviews 16:14621476. Chen Y.H., Chai L.Y. (2011),” Biodegradation of kraft lignin by a bacterial strain Comamonas sp. B-) islated from eroded bamboo slips”, Journal of applied Microbiology 1364-5072. Chen and Lee (1997) "Membrane-mediated extractive fermentation for lactic acid production from cellulosic biomass", Applied Biochemistry and biotechnology 63-65:435-448. Consonni, S., et al. (2005) “Alternative strategies for energy recovery from municipal solid waste - Part A: Mass and energy balances,” Waste Management 25:123. Cysneiros, D. et al. (2011) “Temperature effects on the trophic stages of perennial rye. grass anaerobic digestion,” Water Science & Technology 64(1):70-76. Dahlen, L. et al. (2007). Comparison of different collection systems for sorted household waste in Sweden. Waste Management. 27, 1298-1305. Davis et al. (2012), “Genome Sequence of amycolatopsis sp. strain ATCC 39116, the plant biomss-degrading actinomycete”, Journal of Bacteriology 194(9):2396-2397. Del Borghi et al. (1999), “Hydrolysis and thermophilic anaerobic digestion of sewage sludge and organic fraction of municipal solid waste,” Bioprocess Engineering 20:553-560. Delgenes, J. et al. (2000), “Investigations on the changes in anaerobic biodegradability and biotoxicity of an industrial microbial biomass induced by a thermochemical pretreatment,”. Water Science and Technology 41(3):137-144. Deportes, I. et al. (1998), “Microbial disinfection capacity of municipal solid waste (MSW) composting,” Journal of Applied Microbiology 85:238-246. Diaz, J., et al., (2011), “Co-digestion of different waste mixtures from agro-industrial activities: Kinetic evaluation and synergistic effects,” Bioresource Technology 102:10834. Dong-Yeol Lee et al (2010) “Continuous H2 and CH4 production from high-solid food waste in the theo-stage thermaophilic fermentation process with the recirculation of digester sludge”, Bioresource Technology 101. Dugba Prince N, Zhang Ruihong (1999) “Treatment of dairy wastewater with two-stage anaerobic sequencing batch reactor systems”, Biosource Technology 68:225-233. Eida M.F et al (2012) “Isolation and characterization of cellulose-decomposing bacteria inhabiting sawdust and coffee residue compounds”, Microbes Environ 27(3):226-233. SUBMISSION Biogas Beteilingungs GmbH, 26 August 2010, DE 10 2009 009 985. Fdez-Guelfo et al. (2011-A), “The use of thermochemical and biological pretreatments to enhance organic matter hydrolysis and solubilization from an organic fraction of municipal solid waste (MSW),” Chemical Engineering Journal 168:249-254. Fdez-Guelfo et al. (2011-B), “Biological pretreatment applied to industrial organic fraction of municipal solid wastes (OFMSW): Effect on anaerobic digestion,” Chemical Engineering Journal 172:321-325. Fdez-Guelfo et al. (2012) “New parameters to determine the optimum pretreatment for improving the biomethanization performance,” Chemical Engineering Journal 198-199:81-86. Fukuhara Y et al (2010) “Characterization of the isophthalate degradation genes of momamonas sp. strain E6” Applied and Environmental Microbiology 76(2):519. Gao et al (2008) “Rice straw fermentation using lactic acid bacteria”, Bioresource technology 99:2742-2748. Ge, H. et al. (2010), “Pre-treatment mechanisms during thermophilic-mesophilic temperature phased anaerobic digestion of primary sludge,” Water Research 44:123-130. Ghose, T.K. (1987), Measurement of cellulase activities. Pure & Appl. Chem., 59(2): p. 257-268. Goto et al: (2004), “Hydrothermal conversion of municipal organic waste into resources.” Bioresource Technology 93:279-284. Hansen, T. et al. (2007b). Composition of source-sorted municipal organic waste collected in Danish cities. Waste Management. 27, 510-518. Harris W.L., Dague R.R. (1993) "Comparative performance of anaerobic filters at mesophilic and thermophilic temperatures", Water Environment Research 65(6):764-771. Hartmann, H., and Ahring, B. (2006), “Strategies for the aerobic digestion of the organic fraction of municipal solid waste: an overview,” Water Science & Technology 53(8):7. Hyun-Woo Kim et al (2011) “A comparison study on the higerate co-digestion of sewage sludge and good waste using a temperature-phased anaerobic sequencing batch reactor system”, Bioresource Technology 102:7272-7279. Iwaki H et al.(2011),"Tropicibacter phthalicus sp.nov., A Phthalate-Degrading bacterium from seawater", Curr. Microbiol 64:392-396. Iwaki H.et al (2012) “Isolation and characterization of marine bacteria capable of utilizing phthalate”, Workd J Microbiol Biotecnol 28:1321-1325. Jensen, J. et al. (2010), “Enzymatic processing of municipal solid waste,” Waste Management 30:2497-2503. Jensen, J., et al. (2011) “Cellulase hydrolysis of unsorted MSW,” Appl. Biochem. Biotechnol. 165:1799.-1811. Ji S et al (2012) “An untapped Bacterial cellulytic community enriched from coastal marine sediment under anaerobic and thermophilic conditions”, Microbiol Lett 335:39-46. Kaiser S.K et al (1995) “Initial studies on the temperature-phased anaerobic biofilter process, Water environment research”, 67(7):1095-1103. Kask, S., et al. (1999), “A study on growth characteristics and nutrient consumption of Lactobacillus plantarum in A-stat culture,” Antonie van Leeuwenhoek 75:309. Kato et al (2004), “Clostridium straminisolvens are, Nov, a moderately thermophilic aerotolerant and cellulolytic bacterium isolated from a cellulose-degrading bacterial community”, International Journal of Systematic anc Evolutionary Microbiology 54:2043-2047. Kato et al (2005) “Stable Coexistence of Five Bacterial Strains as a celllose-degrading community”, Applied and environmental microbiology 71(11):7099-7106. Kim H.W et al (2004) “Anaerobic co-digestion of sewage sludge and food waste using a temperature-phased anaerobic digestion process”, Water Science and Technology 55(9):107-114. Kim, D., and Kim, M., (2012), “Thermophilic fermentive hydrogen production from various carbon sources by anaerobic mixed cultures,” International Journal of Hydrogen Energy 37: 2021. Kornillowicz-Kowalska T., Bohacz J(2010), “Dynamics of growth and succession of bacterial and fungal communities during composting of feather waste”, Bioresource Technoly 101:1268-1276. Kristensen et al. (2009), “Yield determining factors in high-solids enzymatic hydrolysis of lignocellulose,” Biotechnology for Biofuels 2:11. Kubler, H. and Schertler, C, (1994) "Three phase anaerobic digestion of organic wastes," Water Science and Technology 30(12):367-374. Kumar et al (2008) “Bioconversion of lignocellulosic biomass: biochemical and molecular perspectives”, J Ind Microbiol Biotechnol 35:377-391. Lafitte-Trouque S., Forster C.F. (2000) "Dual anaerobic co-digestion of sewage sludge and confectionery waste", Bioresource Technology 71:77-82. Latorre I et al (2012) “PVC biodeterioration and DEHP leaching by DEHP-degrading bacteria”, International Biodeterioration and Biodegradation 69:73-81. Lee, D. et al. (2010), “Continuous H2 and CH4 production from high solid food waste in the two-stage thermophilic fermentation process with the recirculation of digester sludge,” Bioresource Technology 101:S42. Li, A. et al. (2007) “Bioconversion of municipal solid waste to glucose for bioethanol conversion,” Bioprocess. Biosyst. Eng. 30:189-196. Li, S. et al. (2012), “Production of fermentable sugars from enzymatic hydrolysis of pretreated municipal solid waste after autoclave process,” Fuel 92:84-88. Liang et al (2008) “Phthalates biodegration in the environment”, Appl Microbiol Biotechnol 80:183-193. Liang et al (2010) “Genetic diversity of phthalic acid esters-degrading bacteria isolated from different geographical regions of China”, Antonie Leeuwenhoek 97:79-89. Liong,M. and Shah, N. (2005), “Optimization of chlolesterol removal, growth and fermentation patterns of Lactobacillus acidophilus ATCC 4862 in the presence of mannitol, fructo-oligosaccharide and inulin: a response surface methodology approach,” Journal of Applied Microbiology 98:1115 . Lv, W. et al. (2010), “Putting microbes to work in sequence: Recent advances in temperature-phased anaerobic digestion processes,” Bioresource Technology 101:9409. Maki et al (2012) “Newly isolated and classified bacteria with great application potential for the composition of lignocellulosic biomass”, J Microbiol Biotechnol 22:15666. Malkow, T. (2004) “Novel and innovative pyrolysis and gasification technologies for energy efficient and environmentally sound MSW disposal”, Waste Management 24:5379. Matthews et al (2004) “Lactic acid bacteria as a potential source of enzymes for use in vinification”, Applied and environmental microbiology 70(10):5715-5731. Matthews et al (2006), “A survey of lactic acid bacteria for enzymes of interest to enology”, Australian journal of grape and wine research 12:235-244. Meyers, S.A. et al. (1996) "Lipase production by lactic acid bacteria and activity on butter oil", Food microbiology 13:383-389. Morita, M., and Sasaki, K. (2012), “Factors influencing the degradation of garbage in methanogenic bioreactors and impacts on biogas formation,” Applied Microbiol. Biotechnol. 94:575-582. Muhle, S. et al. (2010). Comparison of carbon emissions associated with municipal solid waste management in Germany and the UK. Resources Conservation and Recycling. 54, 793-801. Nakasaki, K. et al. (1996) “The use of Bacillus lichenformis HA1 to accelerate composting of organic wastes,” Compost. Sci. & Utilization 4(4):1. Nakasaki, K. et al. (2013) “Inoculation of Pichia kudriavzevii RB1 degrades the organic acids present in raw compost material and accelerates compositing,” Bioresource Technology 144:521. Navacharoen A., Vnagnai A.S (2011) “Biodegradation of diethyl phthalate by an organic-solvent-tolerant bacillus subtilis strain 3C3 and effect of phthalate ester coexistence”, International Biodeterioration and Biodegradation 65:818-816. Or, M., et al. (2011), “Lactic acid production from non-food carbohydrates by thermotolerant Bacillus coagulans,” J. Ind. Microbiol. Biotechnol. 38:599. Papadimitriou, E.K., (2010) “Hydrolysis of organic matter during autoclaving of commingled household waste,” Waste Management 30:572. Parajo et al (1997) “Production of lactic acid from lignocellulose in a single stage of hydrolysis and fermentation, Food Biotechnology 11(1):45-58. Park et al (2009) “Biodegradation of diisodecyl phthalate (DIDP) by bacillus sp. SB-007”, Journal of Basic Microbiology 46:31-35. Patel, M., et al. (2005), “Simultaneous saccharification and co-fermentation of crystalline cellulose and sugar cane bagasse hemicellulose hydrolysate to lactate by thermotolerant acidophilic Bacillus sp.” Biotechnol. Program 21:1453. Riau et al (2010) “Temperature-phased anaerobic digestion (TPAD) to obtain class A biosolids: A semi-continuous study”, Bioresource Technology 101:2706-2712. Riber, C. et al. (2007) Method for fractional solid-waste sampling and chemical analysis. International Journal of Environmental Analytical Chemistry 87 (5), 321-335. Riber, C. et al. (2009), “Chemical composition of material fractions in Danish household waste,” Waste Management 29:1251. Sakai et al. (2000) "Selective proliferation of lactic acid bacteria and accumulation of lactic acid during open fermentation of kitchen refuse with intermittent pH adjustment", Food Sci. Tech. 6(2):140-145. Sakai et al. (2004) "Flourescent In Situ hybrdaization of open lactic acid fermentation of kitchen refuse using rRNA-targeted oligonucleotide Probes", Journal of Bioscience and Bioengineering, 98(1):58-56. Sasaki et al (2012) “Acceleration of cellulose degradation and shift of product via methanogenic co-culture of a cellulolytic bacterium with a hydrogenotrophic methanogen”, Journal of Bioscience and Bioengineering 114(4):435-439. Schmidt and Padukone (1997) "Production of lactic acid from wastepaper as a cellulosic feedstock", Journal of industrial Microbiology and Biotechnology 18:10-14. Schmit Kathryn H., Ellis Timothy G (2001) "Comparison of Temperature-Phased and Two-Phase Anaerobic Co Digestion of Primary Sludge and Municipal Solid Waste", Water Environment Research 73:314-321. Schneider, R., (2002). “Sustainable recovery of animal by-products, of which the disposal is regulated, in a pilot facility at the animal by-product recovery plant. of St. Erasmus.” Final report to the Bavarian Ministry for State-Development and. Environmental Affairs, Germany. Project No. E79, ATZ-EVUS, Center for. Development and Process Engineering, Sulzbach-Rosenberg, Germany. Shanwei Xu et al.(2012) “Biodegradation of specified risk material and fate of scrapie prions in compost, Journal of environmental science and health”, Part A 48:26-36. Shiratori H et al (2006) “Isolation and characterization of a new clostridium sp. that performs effective cellulosic waste digestion in a thermophilic methanogenic bioreactor”, Appl Environ Microbiol 72(5):3702-3709. Shiratori H et al (2009) “Clostridium clariflavum sp. Nov. and clostridium caenicola sp.nov., moderately thermophilic cellulose-/cellobiose-digesting bacteria isolated from methanogenic sludge”, Inernational Journal of Systematic and Evolutionary Microbiology 59:1764-1770. Simmons, P. et al. (2006). The state of Garbage in America. Biocycle. 47, 26-43. Six and Debaere (1992) “Dry anaerobic conversion of municipal solid waste by means of the Dranco process, Water Science and Technology 25(7):295-300. Sizova et al (2011), “Cellulose- and Xylan- Degrading Thermophilic Anaerobic Bacteria from Biocompost”, Appliced and Environmental Microbiology 77(7):2282-2291. Stehlik Petr. (2009) “Contribution to advances in waste-to-energy technologies,” Journal of Cleaner Production 17:919. Supaphol, S. et al. (2011), “Microbial community dynamics in mesophilic anaerobic co-digestion of mixed waste,” Bioresource Technology 102:4021-4027. Tai et al (2004), “Isolation and characterization of a cellulytic geobacillus thermoleovorans T4 strain from sugar refinery wastewater”, Extremophiles 8:345-349. Tonini, T., and Astrup, T. (2012) “Life-cycle assessment of a waste refinery process for enzymatic treatment of municipal solid waste,” Waste Management 32:165176. Van den Keybus (2006) WO2006/029971. Wu et al. (2010) “Complete degradation of di-n-octyl phthalate by biochemical cooperation between Gordonia sp- strain JDC-2 and Arthrobacter sp. Strain JDC-32 isolated from activated sludge”, Journal of Hazardous Material 176:262-268. Wu, S., et al. (2008), “Dark fermentive hydrogen production from xylose in different bioreactors using sewage sludge microflora,” Energy & Fuels 22:113. Wu et al (2011) “Isolation and characterization and characterization of four di-nbutyl phthalate (DBP)-degrading gordonia sp. strains and cloning the 3,4 phthalate diozygenase gene”, World J Micorbiol Biotecnol 27:2611-2617. Yang et al (2001), "Bioconversion of corn straw by coupling ensiling and solid-state fermentation", Bioresource technology 78:277-280. Yoshida, H., Takavoli, O., (2004). “Sub-critical water hydrolysis treatment for waste. squid entrails and production of amino acids, organic acids, and fatty acids.”. Journal of Chemical Engineering of Japan 37(2), 253-260. Yu et al (2012) “Experimental and modeling study of a two-stage pilot scale high solid anaerobic digester system”, Bioresource Technology 124:8-17. Zhang et al. (2007), “Extracellular enzyme activities during regulated hydrolysis of high-solid organic wastes”, Water Research 41:4468-4478. Zhang, D. et al. (2010), “Municipal solid waste management in China: Status, problems and challenges,” Journal of Environmental Management 91:1623. Zverlov et al (2010) “Hydrolytic bacteria in mesophilic and thermophylic degradation of plant biomass”, Eng Life Sci 10(6):528-536.

权利要求:
Claims (12)
[0001]
1. METHOD OF PROCESSING URBAN SOLID WASTE (MSW), characterized by comprising the steps of - provision of a non-separated MSW stream to a microbial fermentation reactor in which the MSW is fermented with stirring at a non-aqueous content between 10 and 50% by weight and at a temperature between 35 and 75°C for a period of between 1 and 72 hours under conditions sufficient to maintain a concentration of live lactic acid bacteria of at least 1.0 x 1010 CFU/L, wherein a Microbially derived cellulase activity of at least 30 FPU/L is provided by a microbial consortium that provides microbial fermentation, and - removing a fermented unsorted MSW stream from the reactor and subjecting it to a separation step whereby non-degradable solids are removed to provide a slurry of biodegradable components.
[0002]
2. METHOD according to claim 1, characterized in that the incoming MSW stream is inoculated with an inoculum of naturally occurring microorganisms in the waste, and "high" in local waste or local waste components as a food source at fermentation conditions of temperature within the range of 37 to 55°C, or 40 to 55°C, or 45 to 50°C, and at a pH within the range of 4.2 and 6.0.
[0003]
3. METHOD according to one of claims 1 or 2, characterized in that the water content has been added to the residue in order to reach a suitable non-aqueous content, and/or in which a suitable non-aqueous content is reached by adding to the MSW a constant mass ratio of water between 0.5 and 2.5 kg of water per kg of MSW.
[0004]
4. METHOD, according to any one of the preceding claims, characterized in that cellulase activity is added by inoculation with a selected micro-organism that has extracellular cellulase activity.
[0005]
5. METHOD, according to any one of the preceding claims, characterized in that the slurry of biodegradable components is subjected to post-fermentation after the separation of non-degradable solids.
[0006]
6. METHOD according to any one of the preceding claims, characterized in that the inoculation of the incoming MSW stream is provided by recycling washing water or process solutions used to recover residual organic material from non-degradable solids and/or in which the inoculation of the incoming MSW stream is provided before or concurrently with the addition of enzymatic activities.
[0007]
A METHOD according to any one of the preceding claims, characterized in that at least 40% by weight of the volatile dissolved solids of the slurry of biodegradable components comprise lactate and/or in which at least 40% by weight of the non-aqueous content of the slurry fluid of biodegradable components comprise volatile dissolved solids.
[0008]
8. METHOD, according to any one of the preceding claims, characterized in that microbial fermentation is conducted within the temperature range 45-50°C.
[0009]
9. METHOD, according to any one of the preceding claims, characterized in that MSW has been heated to a temperature not higher than 75°C.
[0010]
A METHOD according to any one of the preceding claims, characterized in that the separated non-biodegradable solids comprise at least about 20% of the dry weight of the MSW, and/or wherein the separated non-biodegradable solids comprise at least 20% of the dry weight of recyclable materials.
[0011]
11. METHOD, according to any one of the preceding claims, characterized in that the separation of non-biodegradable solids is carried out within 36 hours of the beginning of the enzymatic hydrolysis, or in which the separation of non-biodegradable solids is carried out within 24 hours of the beginning of the enzymatic hydrolysis.
[0012]
12. METHOD according to any one of the preceding claims, characterized in that ethanol or lactate are first removed from the slurry of biodegradable components prior to anaerobic digestion to produce biomethane.

类似技术:

---

公开号 | 公开日 | 专利标题

---

US20190375664A1|2019-12-12|Methods of processing municipal solid waste | using microbial hydrolysis and fermentation

---

US10358370B2|2019-07-23|Methods of processing municipal solid waste | using microbial hydrolysis and fermentation

---

Nissilä et al.2014|Dark fermentative hydrogen production from lignocellulosic hydrolyzates–a review

---

Lv et al.2010|Putting microbes to work in sequence: recent advances in temperature-phased anaerobic digestion processes

---

Yu et al.2016|Accelerated acidification by inoculation with a microbial consortia in a complex open environment

---

Prasertsan et al.2017|Direct hydrolysis of palm oil mill effluent by xylanase enzyme to enhance biogas production using two-steps thermophilic fermentation under non-sterile condition

---

Cho et al.2018|Changes in microbial communities during volatile fatty acid production from cyanobacterial biomass harvested from a cyanobacterial bloom in a river

---

Street et al.2014|Mixed microbial cultures for industrial biotechnology: success, chance, and challenges

---

Nguyen et al.2020|Derivation of volatile fatty acid from crop residues digestion using a rumen membrane bioreactor: a feasibility study

---

Louhasakul et al.2021|Valorization of palm oil mill wastewater for integrated production of microbial oil and biogas in a biorefinery approach

---

Cayetano et al.2021|Enhanced anaerobic digestion of waste-activated sludge via bioaugmentation strategy—Phylogenetic investigation of communities by reconstruction of unobserved states | analysis through hydrolytic enzymes and possible linkage to system performance

---

Sun2015|Biogas production from lignocellulosic materials

---

Ke et al.2021|Fed-in-situ biological reduction treatment of food waste via high-temperature-resistant oil degrading microbial consortium

---

Song et al.2021|Anaerobic and Microaerobic Pretreatment for Improving Methane Production from Paper Waste in Anaerobic Digestion

---

OA17181A|2016-04-05|Methods and compositions for biomethane production.

---

Schneider et al.2013|Cascading Approach of Biowaste Treatment to Obtain Value-added Organic By-Products and Biogas

---

Frost2021|A Farm-Based Biorefinery for Chemical Production from Agricultural Residues

---

Jo et al.2018|Enhanced biomethanation of vegetable waste and cellulose by bioaugmentation with rumen culture

同族专利:

---

公开号 | 公开日

---

TN2014000481A1|2016-03-30|

---

MY180118A|2020-11-23|

---

KR102069460B1|2020-01-22|

---

KR20150028812A|2015-03-16|

---

WO2013185778A9|2014-03-20|

---

WO2013185777A1|2013-12-19|

---

CN104769118A|2015-07-08|

---

AP2014008108A0|2014-12-31|

---

IN2014DN10063A|2015-08-14|

---

AU2013275760A1|2015-01-22|

---

CA2874549C|2020-12-22|

---

EA201590010A1|2015-08-31|

---

NZ702906A|2017-09-29|

---

BR112015030765A2|2017-07-25|

---

CA3095401A1|2013-12-19|

---

JP6120955B2|2017-04-26|

---

US20150167022A1|2015-06-18|

---

WO2013185777A4|2014-02-06|

---

PH12014502712A1|2015-02-02|

---

UA119635C2|2019-07-25|

---

US20210130852A1|2021-05-06|

---

SG11201407902YA|2014-12-30|

---

US20190375664A1|2019-12-12|

---

ES2683828T3|2018-09-28|

---

JP2015521533A|2015-07-30|

---

DK3008193T3|2018-09-03|

---

WO2013185778A1|2013-12-19|

---

IL236158D0|2015-01-29|

---

CN113403344A|2021-09-17|

---

PH12014502712B1|2015-02-02|

---

EP2859106A1|2015-04-15|

---

MX2014015231A|2015-04-10|

---

CL2014003386A1|2015-07-31|

---

CA2874549A1|2013-12-19|

---

EA033645B1|2019-11-12|

---

CN108949838A|2018-12-07|

---

AU2013275760B2|2017-08-31|

---

WO2013185778A4|2014-01-30|

---

HUE040271T2|2019-02-28|

---

KR20180064546A|2018-06-14|

引用文献:

---

公开号 | 申请日 | 公开日 | 申请人 | 专利标题

---

---

JPS609879B2|1982-02-03|1985-03-13|Kogyo Gijutsuin|

---

US5190226A|1991-04-29|1993-03-02|Holloway Clifford C|Apparatus and method for separation, recovery, and recycling municipal solid waste and the like|

---

WO1995000313A1|1991-12-20|1995-01-05|Scott & Fyfe Limited|A method of producing a polyolefinic film by a water quench process|

---

US5427650A|1992-06-25|1995-06-27|Holloway; Clifford C.|Apparatus and method for preparation for separation, recovery, and recycling of municipal solid waste and the like|

---

US5465847A|1993-01-29|1995-11-14|Gilmore; Larry J.|Refuse material recovery system|

---

US5795479A|1995-12-01|1998-08-18|Eastern Power Limited|Apparatus and method for waste recycling and conversion|

---

FR2780857B1|1998-07-07|2006-09-22|Novartis Ag|PESTICIDE AGENT|

---

US6397492B1|1999-05-27|2002-06-04|Msw Patents, Inc.|Apparatus and method for processing municipal solid waste|

---

SE515649C2|2000-01-11|2001-09-17|Franz Wroblewski|Processing tools for sorting machines of a kind intended for the processing of goods, in particular garbage|

---

US20040041301A1|2002-08-30|2004-03-04|Bouldin Floyd E.|Method for transforming municipal solid waste into useful material|

---

WO2004101098A2|2003-05-13|2004-11-25|Wst International Limited|Separating small rubbish and organic matters from garbage|

---

US8313921B2|2003-03-24|2012-11-20|Ch2M Hill, Inc.|Reclaimable hybrid bioreactor|

---

US8877992B2|2003-03-28|2014-11-04|Ab-Cwt Llc|Methods and apparatus for converting waste materials into fuels and other useful products|

---

US6962255B2|2003-05-13|2005-11-08|Steven Tse|Apparatus and method of separating medium-sized materials from garbage for collection|

---

US20050166812A1|2003-11-13|2005-08-04|Horizon Fuel And Financial Management, Llp|MSW processing vessel|

---

ITMI20040803A1|2004-04-23|2004-07-23|Sist Ecodeco S P A|METHOD FOR THE PRODUCTION OF NATURAL ENERGY FROM WASTE|

---

BE1016178A3|2004-09-06|2006-04-04|Debailleul Gerard|Method and installation for making green fuel economically.|

---

US7842490B2|2004-11-29|2010-11-30|Inbicon A/S|Enzymatic hydrolysis of biomasses having a high dry matter content|

---

EP1869197A2|2005-04-12|2007-12-26|E.I. Dupont De Nemours And Company|Treatment of biomass to obtain ethanol|

---

CN102827882B|2005-09-30|2014-09-17|东能量生成股份有限公司|Non-pressurised pre-treatment, enzymatic hydrolysis and fermentation of waste fractions|

---

US7955839B2|2006-06-23|2011-06-07|Recology Inc.|Systems and methods for converting organic waste materials into useful products|

---

TW200918192A|2007-01-05|2009-05-01|Sterecycle Ltd|Process and apparatus for waste treatment|

---

JP4028588B2|2007-04-27|2007-12-26|政弘 井筒|How to use lignocellulosic biomass|

---

CN101680004A|2007-06-27|2010-03-24|诺维信公司|methods for producing fermentation products|

---

US7819976B2|2007-08-22|2010-10-26|E. I. Du Pont De Nemours And Company|Biomass treatment method|

---

GB0801787D0|2008-01-31|2008-03-05|Reclaim Resources Ltd|Apparatus and method for treating waste|

---

BRPI0907730A2|2008-02-05|2015-07-14|Syngenta Participations Ag|Systems and processes for biofuel production from biomass|

---

CN101544990A|2008-03-25|2009-09-30|中国科学技术大学|Method for producing gas fuel and byproduct cellulase by using biomass containing lignocellulose through fermentation|

---

GB2460834A|2008-06-09|2009-12-16|Adam Elliston|Converting biowaste into useful commercial products|

---

US20110165639A1|2008-08-15|2011-07-07|Brijen Biotech, Llc|Refinery process to produce biofuels and bioenergy products from home and municipal solid waste|

---

JP5443721B2|2008-09-16|2014-03-19|シャープ株式会社|refrigerator|

---

DE102009009985A1|2009-02-23|2010-08-26|Envio Biogas Beteiligungs Gmbh|Method for concentrating microorganisms in aqueous substrate in wet fermentation process in two- or multi-stage biogas plant, comprises supplying aqueous substrate with microorganisms in a reactor container of the plant|

---

US20110008865A1|2009-06-16|2011-01-13|Visiam, Llc|Integrated waste/heat recycle system|

---

WO2011032557A2|2009-09-15|2011-03-24|Dong Energy Power A/S|Enzymatic treatment of household waste|

---

DE102010004081C5|2010-01-06|2016-11-03|Benteler Automobiltechnik Gmbh|Method for thermoforming and curing a circuit board|

---

GB201001375D0|2010-01-28|2010-03-17|Aerothermal Group Plc|Apparatus and process for treating municipal solid waste|

---

EP2714861B1|2011-06-03|2017-05-17|Accordant Energy, LLC|Method for producing engineered fuel feed stocks from waste material|US10358370B2|2013-06-12|2019-07-23|Renescience A/S|Methods of processing municipal solid wasteusing microbial hydrolysis and fermentation|

---

KR101640303B1|2014-04-24|2016-07-15|경성대학교 산학협력단|Method for decomposing buried livestock carcasses using lactic acid bacteria|

---

DE102014108233B4|2014-06-12|2018-11-08|Petra Rabe|Method for initializing the fermentation process in biogas plants|

---

BR112017003847A2|2014-08-28|2018-02-27|Renescience As|process for solubilizing waste such as municipal solid waste , and process for producing a fermentation product|

---

CN104178526B|2014-09-11|2016-09-07|北京科技大学|A kind of method of two Coherent producing marsh gas through mixed anaerobic fermentation|

---

CN105802871B|2014-12-30|2021-06-18|中国科学院分子植物科学卓越创新中心|Lactobacillus group and application thereof in preparation of straw feed|

---

CN114054481A|2015-11-02|2022-02-18|雷内科学有限公司|Dissolving municipal solid waste with mixed enzymes|

---

CN106121809A|2016-06-24|2016-11-16|国网安徽省电力公司黄山供电公司|A kind of network system electric station based on biomass power generation|

---

CN106396325A|2016-11-14|2017-02-15|安徽新季环保科技有限公司|Microorganism bacterium agent for digesting sludge|

---

CN107176695A|2017-06-30|2017-09-19|常州市协旺纺织品有限公司|A kind of method that utilization microorganism improves cultivation water|

---

ES2885948T3|2018-02-13|2021-12-15|Renescience As|Building materials comprising digestate|

---

WO2019201765A1|2018-04-20|2019-10-24|Renescience A/S|Method for determining chemical compounds in waste|

---

EP3569657A1|2018-06-26|2019-11-20|Renescience A/S|Asphalt mixture composition comprising digestate additive|

---

WO2021018780A1|2019-07-29|2021-02-04|Suez Groupe|Process for anaerobic digestion of carbonaceous material|

---

CN111271034A|2020-01-19|2020-06-12|山西大学|Method for improving biological coal bed gas yield by inducing lower aliphatic alcohol|

法律状态:
2019-10-08| B06U| Preliminary requirement: requests with searches performed by other patent offices: procedure suspended [chapter 6.21 patent gazette]|

---

2021-06-22| B09A| Decision: intention to grant [chapter 9.1 patent gazette]|

---

2021-07-20| B350| Update of information on the portal [chapter 15.35 patent gazette]|

---

2021-08-03| B16A| Patent or certificate of addition of invention granted [chapter 16.1 patent gazette]|Free format text: PRAZO DE VALIDADE: 20 (VINTE) ANOS CONTADOS A PARTIR DE 18/12/2013, OBSERVADAS AS CONDICOES LEGAIS. |

优先权:

---

申请号 | 申请日 | 专利标题

---

US201261658419P| true| 2012-06-12|2012-06-12|

---

PCT/DK2013/050193|WO2013185777A1|2012-06-12|2013-06-12|Methods of processing municipal solid wasteusing concurrent enzymatic hydrolysis and microbial fermentation.|

---

DKPCT/DK2013/050194|2013-06-12|

---

PCT/DK2013/050194|WO2013185778A1|2012-06-12|2013-06-12|Methods and compositions for biomethane production.|

---

DKPCT/DK2013/050193|2013-06-12|

---

PCT/DK2013/050443|WO2014198274A1|2013-06-12|2013-12-18|Methods of processing municipal solid wasteusing microbial hydrolysis and fermentation|

---